ID: 900680518

View in Genome Browser
Species Human (GRCh38)
Location 1:3913767-3913789
Sequence AAGCCAGGAGGTTCTCGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900680514_900680518 2 Left 900680514 1:3913742-3913764 CCATTAGGCAAACCTAATTTTAA 0: 1
1: 0
2: 0
3: 21
4: 275
Right 900680518 1:3913767-3913789 AAGCCAGGAGGTTCTCGTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 88
900680516_900680518 -10 Left 900680516 1:3913754-3913776 CCTAATTTTAATGAAGCCAGGAG 0: 1
1: 0
2: 2
3: 37
4: 209
Right 900680518 1:3913767-3913789 AAGCCAGGAGGTTCTCGTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900680518 Original CRISPR AAGCCAGGAGGTTCTCGTTT TGG Intergenic
900680518 1:3913767-3913789 AAGCCAGGAGGTTCTCGTTTTGG + Intergenic
902577085 1:17385126-17385148 AAGGCAGGAGGATCACCTTTAGG + Intronic
907952098 1:59193616-59193638 TAGCCAGGTGGTTCTGGCTTGGG + Intergenic
910126453 1:83848009-83848031 AATCCTGGAGATTCTGGTTTTGG + Intergenic
912257139 1:108071688-108071710 AAGCCAGGAGGTTCTGAGTAAGG + Intergenic
915291149 1:154884161-154884183 AGGCCAGCAGGTTCCCATTTTGG - Intergenic
917049083 1:170897977-170897999 AAGCCATGACTTTCTGGTTTGGG + Intergenic
917585681 1:176424859-176424881 AAGCCAGGAGGTTCCCTGTCTGG + Intergenic
919049049 1:192489898-192489920 AATGCAGGAGGTTCCTGTTTGGG + Intergenic
921083108 1:211760050-211760072 AAGTCAGAAGGTTCTCACTTAGG + Intronic
922472107 1:225882913-225882935 AAGCCCGGAGGGTCTCCGTTCGG + Intergenic
1063050298 10:2439826-2439848 AAGCAAAGAGGTTTTCATTTTGG - Intergenic
1064242999 10:13647431-13647453 AAGCCCAGAGGTTCTGGCTTTGG - Intronic
1072305604 10:94103873-94103895 AGGCCAGGACATTCTCATTTCGG + Intronic
1074105692 10:110388193-110388215 AAGGCAGGAAGTTCTCAGTTAGG + Intergenic
1074232872 10:111555208-111555230 AAGCCACCAGGCTCTGGTTTGGG - Intergenic
1084210935 11:67622061-67622083 AAGCCGAGAGGTCCTCCTTTGGG - Intergenic
1088752570 11:112856824-112856846 AAGCAAGGAGGGGCACGTTTGGG + Intergenic
1089278896 11:117358764-117358786 AAGGCAGGAGGATCACTTTTAGG - Intronic
1090735111 11:129606110-129606132 TAGCCAGGTGTTTCTCTTTTGGG - Intergenic
1093491392 12:19709160-19709182 AAGGCAGGAGGATCCCGTTGAGG - Intronic
1100569633 12:95835369-95835391 CAGCAAGGAGGCTCTAGTTTGGG + Intergenic
1101319509 12:103661126-103661148 AGGCCAGGAGGTCCTCATTGAGG + Intronic
1103285363 12:119796532-119796554 AAGCCACTAGGTGCTAGTTTTGG - Intronic
1108028352 13:46202064-46202086 AAGTAAGGAGGTTCTAGATTTGG + Intronic
1114940845 14:27608153-27608175 CCCCCAGGAGGTTGTCGTTTAGG + Intergenic
1117096645 14:52305289-52305311 CAGCTAGGAGGTTCTCGTGCTGG - Intergenic
1121379085 14:93445729-93445751 GAGCCTGGAGGTTCTTTTTTTGG + Intronic
1122392907 14:101402520-101402542 AAGCCAGGAGGCCTGCGTTTGGG + Intergenic
1125324629 15:38524451-38524473 AAGCCAGGAGGGTGTCGTTCCGG + Intronic
1128360810 15:66960293-66960315 AAGCCAGGAGGGTATGGTTTAGG + Intergenic
1130155332 15:81345503-81345525 AAGACAGGGGGTGCTCTTTTAGG - Intronic
1136096509 16:27960867-27960889 CAGCCAGAAGGTTCTCGGTGTGG + Intronic
1138269214 16:55682823-55682845 AACCCAGTGGGATCTCGTTTTGG + Intronic
1138551658 16:57752017-57752039 AGGCCAGGAGGTACTCGTTGGGG - Exonic
1142670219 17:1484624-1484646 AACCCGGGAGGTGCTGGTTTTGG + Intronic
1147906174 17:43824609-43824631 AGGCCAGGAGGTGATCTTTTGGG - Intronic
1148908844 17:50929095-50929117 CAGCCAGGCAGTTCTCATTTGGG + Intergenic
1149063262 17:52449537-52449559 AAGCAAGGAGGCACTCTTTTGGG - Intergenic
1149827581 17:59843689-59843711 AAGGCAGGAGGATCCCTTTTAGG + Intergenic
1150470053 17:65429576-65429598 AAGCAAGGAGGATCTCATTTAGG + Intergenic
1152641151 17:81449799-81449821 AAGCCAGGAGGTGCTCGGAGGGG - Intronic
1153129209 18:1835055-1835077 AAGGCAGTGGGTTCTCTTTTGGG - Intergenic
1153276196 18:3370033-3370055 AATCCAGGAGGTTGACGTTGGGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158345548 18:56512767-56512789 AAGCCAGGATGAATTCGTTTAGG - Intergenic
1159366422 18:67471201-67471223 AAACCACGAGGTTTTCATTTAGG + Intergenic
1164055816 19:21621378-21621400 AACCCAGGAGGTTCAGGTTGCGG - Intergenic
929413955 2:41728494-41728516 CAGCCAGGAGCTTCTCCTATAGG - Intergenic
934889056 2:98049968-98049990 AAGCCATGAGGTTCTAGATAAGG + Intergenic
935348980 2:102137357-102137379 CAGCTAGGTGGTTCTCATTTGGG + Intronic
1171339036 20:24412723-24412745 AATCCATGGGGTTCTCTTTTAGG + Intergenic
1175917698 20:62434561-62434583 AAGCCAGGAGGATTTCCTTCTGG - Intergenic
950957592 3:17070995-17071017 AAGCCTGGAGATTCTGGTCTGGG - Intronic
953837311 3:46357976-46357998 AAGCCAGGACGGTCACCTTTGGG + Exonic
953838979 3:46373315-46373337 AAGCCAGGACGGTCACCTTTGGG + Exonic
954334660 3:49909255-49909277 AGGCCAGGAGGTTCTCGTTGGGG + Exonic
954603404 3:51890451-51890473 AAGCTTGGTGGTTCTTGTTTGGG + Intergenic
955598956 3:60623745-60623767 GAGCAAGGAAGTCCTCGTTTCGG + Intronic
962682862 3:137817619-137817641 AAGCAAGGAGGTTGATGTTTAGG - Intergenic
965873325 3:173286593-173286615 TAGCCAGGATGGTCTCGATTTGG - Intergenic
966611525 3:181872642-181872664 AAGCCAGGAAGTTCTAGAGTAGG + Intergenic
970132603 4:12887748-12887770 ATGCCACCAGGTTCTGGTTTGGG + Intergenic
974292255 4:59948035-59948057 AAGGCAGCAGGTTCTCTTCTGGG - Intergenic
974982387 4:68975130-68975152 TAGTCATGAGATTCTCGTTTTGG - Intergenic
978372555 4:108043583-108043605 AAGCCAGGTGGTTTTCGTAAGGG + Intergenic
987712528 5:21521021-21521043 GTGCCAGGATGTTCTGGTTTTGG + Intergenic
988301894 5:29439762-29439784 GTGCCAGGATGTTCTGGTTTTGG - Intergenic
988702634 5:33690408-33690430 AAGCTAGGATGTACTTGTTTTGG - Intronic
990703411 5:58500031-58500053 AAAGCAGCAGTTTCTCGTTTGGG + Intergenic
991762890 5:69940176-69940198 GTGCCAGGATGTTCTGGTTTTGG + Intergenic
991784437 5:70177953-70177975 GTGCCAGGATGTTCTGGTTTTGG - Intergenic
991842116 5:70815216-70815238 GTGCCAGGATGTTCTGGTTTTGG + Intergenic
991876884 5:71178337-71178359 GTGCCAGGATGTTCTGGTTTTGG - Intergenic
991998044 5:72407807-72407829 AAGCCAGTAAGTTCTGGTTTGGG - Intergenic
1001183603 5:169545198-169545220 GAGCCAGGAGGTTCCCATTAAGG + Intergenic
1003072308 6:2954849-2954871 AAGCTAGGAAGTTGTAGTTTAGG - Intronic
1006408041 6:33856498-33856520 AAGGAAGGAGGTTGTTGTTTAGG + Intergenic
1009005124 6:57775363-57775385 GTGCCAGGATGTTCTGGTTTTGG - Intergenic
1013355595 6:109343487-109343509 AAGAAAGGAGGTTCTGATTTAGG - Intergenic
1019004098 6:168781915-168781937 ATGCTAGGAGATTCTCCTTTAGG + Intergenic
1022637184 7:32147597-32147619 ATCCCAGGAGGTTCTCAGTTGGG + Intronic
1024184674 7:46938234-46938256 CAGCCAGGTGGTTCTCACTTGGG - Intergenic
1024505227 7:50156963-50156985 GAGCCAGGAGGTTCAGGTTCAGG - Intronic
1025978314 7:66387082-66387104 AAGCCAGGAGGTGGAGGTTTTGG + Intronic
1027475688 7:78628447-78628469 TAGCCAGTCGGTTCTCCTTTTGG + Intronic
1039848145 8:41340816-41340838 CAGCCAGGCAGTTCTCGTTTAGG + Intergenic
1044435032 8:92151738-92151760 AACCCAGGAGGTTCTGGTTGCGG - Intergenic
1048964267 8:139604039-139604061 GAGCCAGGAAGTTCTCCTTCAGG + Intronic
1051747648 9:20310051-20310073 CAGCCAGGTGTTTCTAGTTTTGG + Intergenic
1053272824 9:36761912-36761934 AACCCAGGAGGCTCTGGTTTTGG - Intergenic
1053323988 9:37125388-37125410 AAGGCAGGAGGATCACGTTGAGG - Intronic
1061646817 9:132009688-132009710 AATCCAGGAGTGGCTCGTTTGGG - Intronic
1061661589 9:132133786-132133808 CAGCCGGGAGGTTCTTGCTTTGG - Intergenic
1061732916 9:132630550-132630572 AAGCCAGGAGTTTCAGGGTTGGG - Intronic
1193660268 X:84248912-84248934 CAGCCAGGAGGTGGTAGTTTTGG - Intergenic
1196515790 X:116608872-116608894 ATGACAGGATTTTCTCGTTTTGG + Intergenic
1199984143 X:152938301-152938323 AAGCCAGAGGGTTCTGGTTGGGG - Intronic