ID: 900683150

View in Genome Browser
Species Human (GRCh38)
Location 1:3928980-3929002
Sequence CCTTCCACACATAGATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683150_900683155 -9 Left 900683150 1:3928980-3929002 CCCCCAAATCTATGTGTGGAAGG No data
Right 900683155 1:3928994-3929016 TGTGGAAGGTCCTAACCCCCAGG No data
900683150_900683156 -1 Left 900683150 1:3928980-3929002 CCCCCAAATCTATGTGTGGAAGG No data
Right 900683156 1:3929002-3929024 GTCCTAACCCCCAGGACCCATGG No data
900683150_900683157 0 Left 900683150 1:3928980-3929002 CCCCCAAATCTATGTGTGGAAGG No data
Right 900683157 1:3929003-3929025 TCCTAACCCCCAGGACCCATGGG No data
900683150_900683164 15 Left 900683150 1:3928980-3929002 CCCCCAAATCTATGTGTGGAAGG No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683150 Original CRISPR CCTTCCACACATAGATTTGG GGG (reversed) Intergenic
No off target data available for this crispr