ID: 900683153

View in Genome Browser
Species Human (GRCh38)
Location 1:3928982-3929004
Sequence GACCTTCCACACATAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683153_900683157 -2 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683157 1:3929003-3929025 TCCTAACCCCCAGGACCCATGGG No data
900683153_900683167 30 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683153_900683156 -3 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683156 1:3929002-3929024 GTCCTAACCCCCAGGACCCATGG No data
900683153_900683164 13 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683153 Original CRISPR GACCTTCCACACATAGATTT GGG (reversed) Intergenic
No off target data available for this crispr