ID: 900683156

View in Genome Browser
Species Human (GRCh38)
Location 1:3929002-3929024
Sequence GTCCTAACCCCCAGGACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683154_900683156 -4 Left 900683154 1:3928983-3929005 CCAAATCTATGTGTGGAAGGTCC No data
Right 900683156 1:3929002-3929024 GTCCTAACCCCCAGGACCCATGG No data
900683152_900683156 -2 Left 900683152 1:3928981-3929003 CCCCAAATCTATGTGTGGAAGGT No data
Right 900683156 1:3929002-3929024 GTCCTAACCCCCAGGACCCATGG No data
900683153_900683156 -3 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683156 1:3929002-3929024 GTCCTAACCCCCAGGACCCATGG No data
900683150_900683156 -1 Left 900683150 1:3928980-3929002 CCCCCAAATCTATGTGTGGAAGG No data
Right 900683156 1:3929002-3929024 GTCCTAACCCCCAGGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683156 Original CRISPR GTCCTAACCCCCAGGACCCA TGG Intergenic
No off target data available for this crispr