ID: 900683158

View in Genome Browser
Species Human (GRCh38)
Location 1:3929004-3929026
Sequence GCCCATGGGTCCTGGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683158_900683164 -9 Left 900683158 1:3929004-3929026 CCTAACCCCCAGGACCCATGGGC No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
900683158_900683167 8 Left 900683158 1:3929004-3929026 CCTAACCCCCAGGACCCATGGGC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683158 Original CRISPR GCCCATGGGTCCTGGGGGTT AGG (reversed) Intergenic
No off target data available for this crispr