ID: 900683159

View in Genome Browser
Species Human (GRCh38)
Location 1:3929009-3929031
Sequence GTCACGCCCATGGGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683159_900683167 3 Left 900683159 1:3929009-3929031 CCCCCAGGACCCATGGGCGTGAC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683159_900683169 28 Left 900683159 1:3929009-3929031 CCCCCAGGACCCATGGGCGTGAC No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683159 Original CRISPR GTCACGCCCATGGGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr