ID: 900683160

View in Genome Browser
Species Human (GRCh38)
Location 1:3929010-3929032
Sequence GGTCACGCCCATGGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683160_900683169 27 Left 900683160 1:3929010-3929032 CCCCAGGACCCATGGGCGTGACC No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683160_900683167 2 Left 900683160 1:3929010-3929032 CCCCAGGACCCATGGGCGTGACC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683160 Original CRISPR GGTCACGCCCATGGGTCCTG GGG (reversed) Intergenic
No off target data available for this crispr