ID: 900683162

View in Genome Browser
Species Human (GRCh38)
Location 1:3929012-3929034
Sequence GAGGTCACGCCCATGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683162_900683169 25 Left 900683162 1:3929012-3929034 CCAGGACCCATGGGCGTGACCTC No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683162_900683170 30 Left 900683162 1:3929012-3929034 CCAGGACCCATGGGCGTGACCTC No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683162_900683167 0 Left 900683162 1:3929012-3929034 CCAGGACCCATGGGCGTGACCTC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683162 Original CRISPR GAGGTCACGCCCATGGGTCC TGG (reversed) Intergenic
No off target data available for this crispr