ID: 900683163

View in Genome Browser
Species Human (GRCh38)
Location 1:3929018-3929040
Sequence CCAAATGAGGTCACGCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683163_900683167 -6 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683163_900683171 25 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683171 1:3929066-3929088 TTAAACGAAGCCATTGGAGTGGG No data
900683163_900683169 19 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683163_900683170 24 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683163 Original CRISPR CCAAATGAGGTCACGCCCAT GGG (reversed) Intergenic
No off target data available for this crispr