ID: 900683164

View in Genome Browser
Species Human (GRCh38)
Location 1:3929018-3929040
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683152_900683164 14 Left 900683152 1:3928981-3929003 CCCCAAATCTATGTGTGGAAGGT No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
900683154_900683164 12 Left 900683154 1:3928983-3929005 CCAAATCTATGTGTGGAAGGTCC No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
900683158_900683164 -9 Left 900683158 1:3929004-3929026 CCTAACCCCCAGGACCCATGGGC No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
900683150_900683164 15 Left 900683150 1:3928980-3929002 CCCCCAAATCTATGTGTGGAAGG No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
900683153_900683164 13 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683164 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type