ID: 900683165

View in Genome Browser
Species Human (GRCh38)
Location 1:3929019-3929041
Sequence TCCAAATGAGGTCACGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683165_900683169 18 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683165_900683170 23 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683165_900683167 -7 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683165_900683171 24 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683171 1:3929066-3929088 TTAAACGAAGCCATTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683165 Original CRISPR TCCAAATGAGGTCACGCCCA TGG (reversed) Intergenic
No off target data available for this crispr