ID: 900683166

View in Genome Browser
Species Human (GRCh38)
Location 1:3929031-3929053
Sequence TGAAAGGCTGTTTCCAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683166_900683175 27 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683175 1:3929081-3929103 GGAGTGGGCCCCAAGCCGGTGGG No data
900683166_900683173 23 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683173 1:3929077-3929099 CATTGGAGTGGGCCCCAAGCCGG No data
900683166_900683171 12 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683171 1:3929066-3929088 TTAAACGAAGCCATTGGAGTGGG No data
900683166_900683170 11 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683166_900683174 26 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683174 1:3929080-3929102 TGGAGTGGGCCCCAAGCCGGTGG No data
900683166_900683176 28 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683176 1:3929082-3929104 GAGTGGGCCCCAAGCCGGTGGGG No data
900683166_900683169 6 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683166 Original CRISPR TGAAAGGCTGTTTCCAAATG AGG (reversed) Intergenic
No off target data available for this crispr