ID: 900683167

View in Genome Browser
Species Human (GRCh38)
Location 1:3929035-3929057
Sequence ATTTGGAAACAGCCTTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683154_900683167 29 Left 900683154 1:3928983-3929005 CCAAATCTATGTGTGGAAGGTCC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683163_900683167 -6 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683165_900683167 -7 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683159_900683167 3 Left 900683159 1:3929009-3929031 CCCCCAGGACCCATGGGCGTGAC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683162_900683167 0 Left 900683162 1:3929012-3929034 CCAGGACCCATGGGCGTGACCTC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683161_900683167 1 Left 900683161 1:3929011-3929033 CCCAGGACCCATGGGCGTGACCT No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683153_900683167 30 Left 900683153 1:3928982-3929004 CCCAAATCTATGTGTGGAAGGTC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683160_900683167 2 Left 900683160 1:3929010-3929032 CCCCAGGACCCATGGGCGTGACC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data
900683158_900683167 8 Left 900683158 1:3929004-3929026 CCTAACCCCCAGGACCCATGGGC No data
Right 900683167 1:3929035-3929057 ATTTGGAAACAGCCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683167 Original CRISPR ATTTGGAAACAGCCTTTCAG AGG Intergenic
No off target data available for this crispr