ID: 900683168

View in Genome Browser
Species Human (GRCh38)
Location 1:3929047-3929069
Sequence TTAACTTGCTTGCCTCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683168_900683173 7 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683173 1:3929077-3929099 CATTGGAGTGGGCCCCAAGCCGG No data
900683168_900683176 12 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683176 1:3929082-3929104 GAGTGGGCCCCAAGCCGGTGGGG No data
900683168_900683179 17 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683179 1:3929087-3929109 GGCCCCAAGCCGGTGGGGTGGGG No data
900683168_900683175 11 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683175 1:3929081-3929103 GGAGTGGGCCCCAAGCCGGTGGG No data
900683168_900683178 16 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683178 1:3929086-3929108 GGGCCCCAAGCCGGTGGGGTGGG No data
900683168_900683184 30 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683184 1:3929100-3929122 TGGGGTGGGGTCCTTATGTGAGG No data
900683168_900683177 15 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683177 1:3929085-3929107 TGGGCCCCAAGCCGGTGGGGTGG No data
900683168_900683170 -5 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683168_900683169 -10 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683168_900683174 10 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683174 1:3929080-3929102 TGGAGTGGGCCCCAAGCCGGTGG No data
900683168_900683171 -4 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683171 1:3929066-3929088 TTAAACGAAGCCATTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683168 Original CRISPR TTAACTTGCTTGCCTCTGAA AGG (reversed) Intergenic
No off target data available for this crispr