ID: 900683169

View in Genome Browser
Species Human (GRCh38)
Location 1:3929060-3929082
Sequence AGCAAGTTAAACGAAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683161_900683169 26 Left 900683161 1:3929011-3929033 CCCAGGACCCATGGGCGTGACCT No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683163_900683169 19 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683159_900683169 28 Left 900683159 1:3929009-3929031 CCCCCAGGACCCATGGGCGTGAC No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683168_900683169 -10 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683165_900683169 18 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683160_900683169 27 Left 900683160 1:3929010-3929032 CCCCAGGACCCATGGGCGTGACC No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683166_900683169 6 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data
900683162_900683169 25 Left 900683162 1:3929012-3929034 CCAGGACCCATGGGCGTGACCTC No data
Right 900683169 1:3929060-3929082 AGCAAGTTAAACGAAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683169 Original CRISPR AGCAAGTTAAACGAAGCCAT TGG Intergenic
No off target data available for this crispr