ID: 900683170

View in Genome Browser
Species Human (GRCh38)
Location 1:3929065-3929087
Sequence GTTAAACGAAGCCATTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900683165_900683170 23 Left 900683165 1:3929019-3929041 CCATGGGCGTGACCTCATTTGGA No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683162_900683170 30 Left 900683162 1:3929012-3929034 CCAGGACCCATGGGCGTGACCTC No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683163_900683170 24 Left 900683163 1:3929018-3929040 CCCATGGGCGTGACCTCATTTGG No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683166_900683170 11 Left 900683166 1:3929031-3929053 CCTCATTTGGAAACAGCCTTTCA No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data
900683168_900683170 -5 Left 900683168 1:3929047-3929069 CCTTTCAGAGGCAAGCAAGTTAA No data
Right 900683170 1:3929065-3929087 GTTAAACGAAGCCATTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900683170 Original CRISPR GTTAAACGAAGCCATTGGAG TGG Intergenic
No off target data available for this crispr