ID: 900686090

View in Genome Browser
Species Human (GRCh38)
Location 1:3948543-3948565
Sequence GAGTTTGCACAGCTGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 379}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900686090_900686093 16 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686093 1:3948582-3948604 CCGCGTCACACTTTCTGTAAAGG 0: 1
1: 0
2: 0
3: 0
4: 46
900686090_900686095 21 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686095 1:3948587-3948609 TCACACTTTCTGTAAAGGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219
900686090_900686094 17 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686094 1:3948583-3948605 CGCGTCACACTTTCTGTAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
900686090_900686098 30 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686098 1:3948596-3948618 CTGTAAAGGGAAGGTAGATGGGG No data
900686090_900686096 28 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG No data
900686090_900686097 29 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686097 1:3948595-3948617 TCTGTAAAGGGAAGGTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900686090 Original CRISPR GAGTTTGCACAGCTGGCAAA TGG (reversed) Intergenic
900686090 1:3948543-3948565 GAGTTTGCACAGCTGGCAAATGG - Intergenic
901675143 1:10878921-10878943 TAGTTTGCACATCTGCAAAATGG - Intergenic
901756814 1:11446439-11446461 GAGCTCATACAGCTGGCAAAAGG + Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902098213 1:13963892-13963914 CAGATAGCACAGCTGGCAATTGG - Intergenic
902786161 1:18734002-18734024 GAGGTTACACAGCTGGTAAACGG + Intronic
903186541 1:21632452-21632474 CAGTTTGCCCTGCTGGCAATTGG - Intronic
903214830 1:21838198-21838220 AAGGTTGCACAGCCAGCAAATGG + Intronic
903376420 1:22869196-22869218 CAGTTTCCTCACCTGGCAAAGGG - Intronic
903474732 1:23611781-23611803 CAGTTTCCACAACTGGAAAATGG - Intronic
903569361 1:24293076-24293098 CAGTTTGCTCATCTGCCAAATGG + Intergenic
903576648 1:24343491-24343513 GAGATTGCACAGCTAGTAAGTGG + Intronic
903649954 1:24916330-24916352 CAGTGTGCTCAGCTGTCAAATGG - Intronic
903854757 1:26330446-26330468 TAGTTTCCACATCTGGAAAAGGG + Intronic
903862663 1:26374287-26374309 GAGGGAGCACAGCTGGCAGATGG - Intronic
905031625 1:34887796-34887818 CAGTTTGCTCAGCTGTCAAATGG + Intronic
905329304 1:37181167-37181189 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
905453133 1:38069913-38069935 GAGGTCACACAGCTGGTAAATGG + Intergenic
905480833 1:38260882-38260904 GACTTAGCACAGTTGGGAAATGG - Intergenic
906167498 1:43697784-43697806 GAGTTTGCAGGCCTGGCATATGG - Intronic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906671597 1:47658981-47659003 TAGTTTCCACATCTGGAAAAAGG + Intergenic
907391868 1:54163406-54163428 CAGTTTCCACAGCCAGCAAAGGG - Intronic
908001659 1:59686236-59686258 TTGTTTGCAAAGCTGGCCAAGGG - Intronic
909046605 1:70718146-70718168 AAGTTTACACAGCTGGCAAATGG + Intergenic
911163956 1:94708900-94708922 GAGTTTGCACAGATGGACATGGG - Intergenic
912192500 1:107356139-107356161 GATTATGCACATCTGGCATAAGG + Intronic
912269594 1:108195372-108195394 GAGTTTGGAAAGGTGACAAAAGG + Intronic
912401721 1:109398375-109398397 GAGCTTGCTCAGCTGGAAAAGGG + Intergenic
912659400 1:111514964-111514986 AAGTTTGCACTGCTAGCAAAGGG + Intronic
912853364 1:113146178-113146200 GTGTTCATACAGCTGGCAAACGG + Intergenic
915108586 1:153549092-153549114 AAGGTTGCACAGCTGGCGACAGG - Intronic
915938550 1:160103535-160103557 GAGGTCACACAGCTAGCAAATGG + Intergenic
916123419 1:161549259-161549281 GAGTTTGCACAGGGAGCAAGGGG - Intronic
916133311 1:161630617-161630639 GAGTTTGCACAGGGAGCAAGGGG - Intronic
916317551 1:163467024-163467046 AAGTTTGCAGAGCTAGTAAATGG + Intergenic
918269979 1:182888993-182889015 GAGTTTTCACAACTTGCAAAGGG - Intergenic
919272808 1:195371952-195371974 GAGATTGCACAGCTAGTAAGTGG + Intergenic
919297276 1:195719012-195719034 GAGGTTGCACAGCTCATAAAGGG - Intergenic
919609090 1:199722831-199722853 GAGAATGCACAGCTGCTAAAAGG - Intergenic
919762934 1:201109835-201109857 CAGTTTCCACATCTGTCAAATGG + Intronic
920962062 1:210672152-210672174 GAGGTTCCACAGCTGGCAAGTGG + Intronic
921294680 1:213690721-213690743 CAGTTTTCTCAGCTGGGAAATGG + Intergenic
921925169 1:220705316-220705338 GAGTTTGCCCAACTGACAAATGG + Intergenic
922088638 1:222374681-222374703 TAGTTTGCCCATCTGTCAAATGG - Intergenic
923141431 1:231163586-231163608 GCGGTCGCACAGCTGGCAGATGG - Exonic
924021159 1:239785085-239785107 GAGGTTGCAAAGCTGGCACATGG - Intronic
1062840224 10:664222-664244 GAGTTTGCACAAAAGGCAGATGG - Intronic
1063006691 10:1978528-1978550 GAGTTTGCAGAGTTGGAAAGAGG + Intergenic
1063361441 10:5462797-5462819 CAGGTTCCTCAGCTGGCAAAGGG - Intergenic
1064437502 10:15324014-15324036 GTGATTGCAGGGCTGGCAAATGG - Intronic
1065045855 10:21747185-21747207 GAGTGTGGACAGTTGGCAGAGGG + Intergenic
1065180360 10:23118745-23118767 CAGTTTGCTCACCTAGCAAATGG - Intronic
1065183533 10:23150237-23150259 AAGGCTGCACAGCTGGCAAGTGG - Intergenic
1065960132 10:30727353-30727375 TAGATGGCAAAGCTGGCAAAGGG - Intergenic
1067172815 10:43922072-43922094 GACTTTGCCCAGGAGGCAAAGGG + Intergenic
1067336719 10:45373151-45373173 GGGTTTGTGCACCTGGCAAATGG - Intergenic
1067362304 10:45594328-45594350 GAGTGTGCACATCTGTAAAATGG - Intronic
1067468982 10:46522778-46522800 AAGGTTACACAGCTGGCAAAGGG + Intergenic
1068082632 10:52338614-52338636 GAGTTCACACAGCTAGCAGAAGG - Intergenic
1068744800 10:60517905-60517927 GAGTTTGCACAGCTAGCCAGTGG - Intronic
1069789199 10:71008860-71008882 CAGTTTCCTCATCTGGCAAATGG + Intergenic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1070742134 10:78910145-78910167 CAGTTTCCACATCTGGTAAAGGG + Intergenic
1071165843 10:82805485-82805507 GATTTTGCAAAGCTGACAAAGGG - Intronic
1071256051 10:83872746-83872768 AAGTTTGCAGAGCTGGTAATTGG + Intergenic
1071591525 10:86878861-86878883 GAGTTTGGTTAGCTGGGAAAAGG + Intronic
1072419360 10:95276750-95276772 GAGGTTGCACAGCTGGTGAGCGG + Intronic
1072899999 10:99398889-99398911 GAGATTGCACAGCTGGTCAATGG + Intronic
1073045647 10:100636580-100636602 GAAATCGCACAGCTGGCAAATGG - Intergenic
1074446945 10:113528486-113528508 CAGTTTCCTCATCTGGCAAATGG + Intergenic
1075081584 10:119387572-119387594 GAGTTTGCCCAGCTGGTCAGGGG + Intronic
1075344596 10:121673021-121673043 GAGTTTGCCCAGAGGGCAAGAGG + Intergenic
1075445719 10:122511336-122511358 GAGGTCACACAGCTAGCAAATGG + Intronic
1075623358 10:123944130-123944152 GAGGTCACACAGCAGGCAAAAGG - Intergenic
1076468513 10:130702513-130702535 ATGTGTGCACAGCTGGCAGAGGG + Intergenic
1076751290 10:132544719-132544741 GGGCATGCAGAGCTGGCAAACGG - Intronic
1076893325 10:133295908-133295930 AAGTCTGCACAGGTGGCACAAGG + Intronic
1078549958 11:12273200-12273222 GAGTTTTCTCAGCAGGAAAATGG + Intergenic
1078735937 11:14020803-14020825 GAGGTCACACAGCTGGTAAATGG - Intronic
1079574736 11:21989394-21989416 TTGTTTGCACAGCGTGCAAATGG + Intergenic
1080171740 11:29311929-29311951 CAGGTTGCACAGTGGGCAAAGGG - Intergenic
1080775784 11:35385367-35385389 CAGTTTGCTCACCTGGTAAAAGG - Intronic
1081750638 11:45508363-45508385 GAGTTTACACAGCTGGTGAATGG - Intergenic
1081894650 11:46574802-46574824 AAGGTTATACAGCTGGCAAATGG - Intronic
1082070360 11:47934755-47934777 CAGTTTGCACATCTGTAAAATGG - Intergenic
1083297684 11:61724016-61724038 GAGGTTACACAGCTAGAAAATGG + Intronic
1083960303 11:66011669-66011691 GAGGTTACACAGCTAGGAAATGG + Intergenic
1084683226 11:70679293-70679315 AAGGTCACACAGCTGGCAAATGG + Intronic
1085227616 11:74936576-74936598 GAGGTTCCACAGCTAGTAAATGG - Intronic
1085521747 11:77143168-77143190 AAGTTTGCGCAGCTAACAAATGG - Intronic
1086054834 11:82634480-82634502 GAGAACGCACAGCTGGCAAGCGG + Intergenic
1086339239 11:85830589-85830611 GAGTTTGCTCAGCCCACAAAGGG + Intergenic
1088460180 11:110074735-110074757 GAGTTTTCACTCATGGCAAAAGG + Intergenic
1089387110 11:118075594-118075616 TAGTTTCCTCAGCTGACAAATGG + Intergenic
1089433489 11:118441917-118441939 GAGTCTGCACAGCTGCCCCACGG - Intronic
1090422913 11:126588049-126588071 GAGGTCACACAGCTAGCAAACGG - Intronic
1090452396 11:126818204-126818226 GTGTTTTCACAGCTGGGGAAAGG + Intronic
1090452719 11:126820838-126820860 TAGTTTCCACACCTGGAAAAGGG - Intronic
1090731646 11:129577943-129577965 AAGATTGCACAGCTGGCCAGAGG + Intergenic
1090930878 11:131297183-131297205 CAGTTTTCTCATCTGGCAAACGG + Intergenic
1090974768 11:131671605-131671627 GACTTGGCAGAGGTGGCAAATGG + Intronic
1091456011 12:608523-608545 GAGATTACACAACTAGCAAATGG + Intronic
1091695017 12:2622555-2622577 AATTCTGCACAGCTGGGAAAAGG - Intronic
1092170006 12:6368645-6368667 CAGTTGGCACAGCTAGCAAATGG + Intronic
1092773044 12:11915841-11915863 GAGATTACACAGCTAGTAAATGG - Intergenic
1095158360 12:38886239-38886261 TAGTTTACACAGCTAGTAAATGG - Intronic
1095389005 12:41683181-41683203 GGCTTTGCACATCTGGCATAGGG - Intergenic
1096514324 12:52147858-52147880 CAGTTTGGACAGATGGCACATGG - Intergenic
1099158033 12:79204067-79204089 AAGTTTGCACAGCTAGTAAGTGG - Intronic
1100141582 12:91625545-91625567 GTGTTTTTACAGCTGGAAAATGG - Intergenic
1101101736 12:101400588-101400610 GAGCTTGCACACCTGGCTCAGGG - Intronic
1101217421 12:102597917-102597939 TAGTTTCCTCAGCTGGAAAATGG - Intergenic
1101583366 12:106064013-106064035 TAGTTTACACATCTGCCAAAGGG - Exonic
1101853936 12:108426653-108426675 CAGGTTACACAGCTGGGAAAAGG + Intergenic
1102184910 12:110940513-110940535 CAGTTTCCACATCTGCCAAATGG + Intergenic
1102209687 12:111116947-111116969 GAGGTTGCAGAGCTGGCAAGTGG + Intronic
1102604076 12:114055365-114055387 TAGTTTTCCCAGCTGGAAAATGG - Intergenic
1103000158 12:117379333-117379355 GAGTTTTAAATGCTGGCAAAGGG + Intronic
1103214601 12:119191866-119191888 AAGGTTGCTCAGCTGGCAAATGG - Intronic
1103250421 12:119495143-119495165 AAAGTTGCACAGCTAGCAAAAGG + Intronic
1103361519 12:120357261-120357283 CAGTTTCCACATCTGTCAAATGG - Intronic
1103572740 12:121856045-121856067 CAGTTTCCACAGCTGCCAGATGG - Intronic
1103944121 12:124516946-124516968 CAGTTTTCCCATCTGGCAAATGG - Intronic
1104065333 12:125300748-125300770 GAGGCCACACAGCTGGCAAAGGG + Intronic
1104433985 12:128741080-128741102 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
1106135843 13:26972918-26972940 GAGAAAGCACAGCTGGAAAATGG + Intergenic
1106368166 13:29104279-29104301 CAGTTTGCTCAGCTGTAAAATGG - Intronic
1107205145 13:37776119-37776141 GTGTTTAGTCAGCTGGCAAATGG - Intronic
1107224380 13:38029637-38029659 GTCTTTGTACAGCTTGCAAATGG + Intergenic
1107729399 13:43333299-43333321 GATTATGCACTGTTGGCAAAGGG - Intronic
1108550795 13:51541999-51542021 GAGATTACCCAGCTGGCACATGG + Intergenic
1109751983 13:66706351-66706373 AAATTTGCACAGCTGGTAACTGG - Intronic
1110599647 13:77358134-77358156 AAGTTAGCAAAGCTTGCAAAAGG - Intergenic
1115076271 14:29395214-29395236 CAGTTTCCCCAGCTGTCAAATGG + Intergenic
1115479406 14:33846428-33846450 GAGTTTGCCAGGCTGGCGAATGG - Intergenic
1118272542 14:64356937-64356959 GAGCACACACAGCTGGCAAATGG + Intergenic
1118494453 14:66294511-66294533 TAGTTTGCACATCTGCAAAATGG + Intergenic
1118581181 14:67299895-67299917 GAGTTTCTTCAGCTGTCAAAAGG + Intronic
1118661529 14:68018880-68018902 AAGTTTTCACAGCTGGTAAATGG - Intronic
1119966841 14:78926020-78926042 GAGTTTCCTCAGCTGTAAAAGGG - Intronic
1120662131 14:87262918-87262940 AAGTTTGCTCAGCAGCCAAAGGG + Intergenic
1121052886 14:90830993-90831015 GAGTTTCCCCACCTGGGAAAGGG - Intergenic
1121323422 14:93006192-93006214 GAGTTTGACCAGCTTGCACATGG - Intronic
1121514747 14:94542183-94542205 CAGTTTTCACATCTGGAAAATGG - Intergenic
1122406896 14:101506111-101506133 CAGTTTCCACATCTGTCAAATGG - Intergenic
1122648401 14:103210290-103210312 AAATTTTCAAAGCTGGCAAAAGG - Intergenic
1124583653 15:30985565-30985587 TAGTTTTCACATCTGTCAAATGG + Intronic
1124650985 15:31473836-31473858 GAGTTAGCACAGATGGGAGAAGG - Intergenic
1125025094 15:35021701-35021723 GAGGTTAAACAACTGGCAAAAGG - Intergenic
1126729076 15:51663316-51663338 GAGTTGGCACAGTTGGCAGTAGG + Intergenic
1129238303 15:74236856-74236878 CAGTTTTCACAGCTGTGAAATGG + Intronic
1129451593 15:75654253-75654275 GAGTTTCCACATCTGTAAAATGG - Intronic
1129940691 15:79494513-79494535 GAGCTTGCACAGCTGGGGAGTGG + Intergenic
1130056137 15:80527717-80527739 CAGTTTGCACAGCTGGTAACTGG + Intronic
1131121655 15:89826843-89826865 GTGTTTCCTCAGCTGGGAAATGG - Intergenic
1131315926 15:91337439-91337461 GGATTTGCACAGCTAGCAAGAGG - Intergenic
1131679971 15:94710915-94710937 CAGTTTTCTCAGCTGGGAAATGG + Intergenic
1131910110 15:97189170-97189192 GAGTTTACAAAGCTGGCAGGTGG + Intergenic
1133178325 16:4033043-4033065 GTGTTTGCACAGCAACCAAATGG - Intronic
1133322977 16:4925717-4925739 GAGTTTACACAGCTGGGAAGTGG + Intronic
1133336338 16:5008919-5008941 GAGTTTCCCCATCTGGGAAATGG + Intronic
1133769995 16:8862247-8862269 CAGTTTCCACATCTGGAAAATGG + Intronic
1133771026 16:8867321-8867343 GAGTTTCCTCATCTGTCAAAGGG + Intronic
1134787399 16:16957193-16957215 TAGTTTTCACATCTGGGAAATGG - Intergenic
1135013354 16:18903694-18903716 AAGGTTGCACAGCTTGTAAAAGG + Intronic
1135051280 16:19195032-19195054 AAGTTCACACAGCTGGGAAATGG - Intronic
1135320285 16:21491290-21491312 ATGGTTGCACAGCTTGCAAAAGG + Intergenic
1135373120 16:21922780-21922802 ATGGTTGCACAGCTTGCAAAAGG + Intergenic
1135438669 16:22447922-22447944 ATGGTTGCACAGCTTGCAAAAGG - Intergenic
1135943878 16:26846857-26846879 GAGGTTGCACAGCTGGAAGGAGG + Intergenic
1135948001 16:26882331-26882353 GAGATTGCTGAGCTGGCAAGTGG - Intergenic
1135953820 16:26939106-26939128 GAGTTTGTACAGCTGCCCACAGG - Intergenic
1136330510 16:29572988-29573010 AAGGTTGCACAGCTTGTAAAAGG + Intergenic
1136344915 16:29668776-29668798 GATTTTGCAAAGCTGGGAAAAGG + Exonic
1136445140 16:30312708-30312730 AAGGTTGCACAGCTTGTAAAAGG + Intergenic
1137560444 16:49498870-49498892 TAGTTTGCACTTCTGACAAACGG + Intronic
1137576815 16:49605350-49605372 GAGGTTGCACAGCTGGCCAGAGG - Intronic
1137611765 16:49822817-49822839 CAGTTTGCTCATCTGTCAAATGG - Intronic
1138231291 16:55338441-55338463 GAGGATGCACAGCTAGTAAATGG - Intergenic
1138332990 16:56230293-56230315 GTGTTTGCACAGGGGGCGAATGG - Intronic
1139192532 16:64881224-64881246 TTGTTTGCACAGCTGGAAAAGGG + Intergenic
1140439282 16:74974505-74974527 GAGTTGGCACAGCGGGCATGAGG + Intronic
1140865793 16:79060988-79061010 AAGCTTGCACAGCTAGTAAATGG + Intronic
1141195141 16:81854775-81854797 CAGTTTGCTCAGCTGTGAAATGG + Intronic
1141253952 16:82383691-82383713 GAAATTGAACAGCTTGCAAAAGG + Intergenic
1141746922 16:85932056-85932078 CAGTTTCCTCACCTGGCAAATGG + Intergenic
1144852978 17:18253432-18253454 CAGCTTGCTCAGCTTGCAAATGG + Exonic
1146692931 17:34889193-34889215 AGGTTTGCACAGCTGGTAAGTGG + Intergenic
1147427304 17:40352042-40352064 GTATTTGCCCAGCTGGCAGAGGG - Exonic
1148491592 17:48026909-48026931 GATGTGGCATAGCTGGCAAAGGG + Intronic
1149496421 17:57120965-57120987 GAGTTTGCACAAATAGAAAATGG - Exonic
1151360312 17:73584714-73584736 GAGTTTCCTCAACTGTCAAATGG + Intronic
1151428079 17:74044093-74044115 AAGGCTGCACAGCTGGCAAGGGG - Intergenic
1151473120 17:74330236-74330258 CAGGCTGCACAGCTGGCAAATGG - Intronic
1151694795 17:75708927-75708949 GAGTTTGCTCATCTTCCAAAGGG + Intergenic
1152028006 17:77824249-77824271 GAGTTTGCCAAGCAGACAAAGGG + Intergenic
1155408737 18:25518553-25518575 GAGGTCACACAGCTGGCAAGTGG - Intergenic
1157153859 18:45245572-45245594 GAGTGTGCACAGCAATCAAAAGG - Intronic
1157497231 18:48164961-48164983 GAGGTCACCCAGCTGGCAAAGGG + Intronic
1157623688 18:49031189-49031211 GAGCTTTCACAGTTGGCACATGG + Intergenic
1157718128 18:49903216-49903238 GAGTGTCCACAGCAGGCTAATGG + Intronic
1158932260 18:62333610-62333632 GAGTTTGCACAGCTAGTGAGTGG + Intronic
1159037244 18:63289551-63289573 GAATTTGAACAGCTGGATAAAGG + Intronic
1160613750 18:80109035-80109057 GAGTTTGCACAGATGTGGAAAGG + Exonic
1161251497 19:3282763-3282785 CAGTTTGCTCATCTGGAAAATGG + Intronic
1161630663 19:5353668-5353690 CAGTTTGCTCAGCTGCAAAAAGG - Intergenic
1162032084 19:7921857-7921879 GAGTCCACAGAGCTGGCAAAAGG - Intronic
1162846155 19:13394231-13394253 GAGTTCACACAGCTAGCACATGG + Intronic
1163599367 19:18239446-18239468 CAGTTTGCCCATCTGGGAAATGG + Intronic
1165693739 19:37884611-37884633 GTGTTTCCAGAGCTGGGAAAGGG + Intergenic
1167146648 19:47684723-47684745 AAGGTTGCACAGCTGGCAAATGG + Intronic
1167538664 19:50071655-50071677 GAGACAGCACAGCTGGCAAAGGG - Intergenic
1168154917 19:54467985-54468007 CAGTTCATACAGCTGGCAAAGGG - Intronic
925535683 2:4913654-4913676 TGGTTTGCAAAGCTGGAAAAAGG - Intergenic
925904738 2:8533751-8533773 GAGTTTCCACGGCTGGAGAAAGG - Intergenic
926311514 2:11679192-11679214 CAGTTTTCTCAGCTGTCAAATGG - Intronic
927172614 2:20382753-20382775 TATTTTGCAAAGCTGGGAAAAGG + Intergenic
927485472 2:23485749-23485771 GAGGTTGCACAGCTGGAAAGGGG - Intronic
927653740 2:24928445-24928467 AAGGTTCCACAACTGGCAAAGGG + Intergenic
927708581 2:25311778-25311800 GTGTTTGCTCAGCTGGAAAATGG - Intronic
927841679 2:26448996-26449018 GAGCTGGCCCAGCTGGAAAATGG + Intronic
928285839 2:29989347-29989369 CAATTTGCACAGCTGGTAAGTGG - Intergenic
928360222 2:30656521-30656543 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
929001199 2:37348604-37348626 GAGTTGGCCCAGCTTGCAAAGGG - Intronic
929009478 2:37426793-37426815 AAGTTTTCACAGCTAGTAAATGG - Intergenic
931084016 2:58808713-58808735 GGGTTTTCACACCTGTCAAATGG + Intergenic
933801043 2:85960750-85960772 CAGTTTCCACAGCTGGCACCAGG + Intergenic
933907102 2:86905688-86905710 GAATTTTCACTGCTGGTAAATGG + Intergenic
933908348 2:86915350-86915372 GAATTTTCACTGCTGGTAAATGG + Intronic
935688759 2:105711646-105711668 TAGTTTACACAGCTGGTAATTGG + Intergenic
936365067 2:111846039-111846061 GAATTTTCACTGCTGGTAAATGG - Intronic
936935532 2:117835693-117835715 GAGTGTCCACAGCTGGGAAAGGG + Intergenic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
937304523 2:120862979-120863001 GAGTTTTTGCAGCTGGCAAGGGG - Intronic
941297438 2:163757703-163757725 GAGGTCACACAGCTAGCAAATGG + Intergenic
941477340 2:165966351-165966373 CAGTTTCCACAACTGGGAAAAGG + Intergenic
941591458 2:167425554-167425576 TGGTCTGCACAGCTTGCAAATGG - Intergenic
941835607 2:170015334-170015356 GTGCAAGCACAGCTGGCAAAAGG + Exonic
944415575 2:199476176-199476198 AAGTTTACACAGCTAGTAAATGG - Intergenic
946018668 2:216624163-216624185 GAGTTTACACAGCTAGTAAATGG + Intergenic
946032773 2:216718101-216718123 CAGTTTACTCATCTGGCAAATGG + Intergenic
947107183 2:226679822-226679844 GAGTTAGCTCAGCTGTCAGATGG + Intergenic
947831559 2:233145257-233145279 GAGGTCGCACAGCTAGTAAATGG - Intronic
947847102 2:233253300-233253322 GAGGTTGCACAGCAGGTTAATGG + Intronic
1169544188 20:6634350-6634372 GAGTTTACACAGCAGGCAACAGG + Intergenic
1170119656 20:12898018-12898040 GATGTTGCACAGCTAGTAAATGG - Intergenic
1171089947 20:22275576-22275598 GAGTTTGAACAGCTCCAAAAGGG - Intergenic
1172046830 20:32086423-32086445 TAGTGTGCACAGCTGGGAAGTGG + Intronic
1172222987 20:33286412-33286434 GAGTTTCCACAGCCTGCAGAAGG + Intronic
1172571941 20:35977383-35977405 GAGCTAGCACATCTGGCCAAAGG - Intronic
1172840444 20:37900073-37900095 AAGTTTACACAGCTACCAAATGG + Intergenic
1173153527 20:40588117-40588139 AAGTTTCCACAGCTTGCAAATGG - Intergenic
1174827187 20:53778814-53778836 CAGTTTTCCCACCTGGCAAAGGG + Intergenic
1175407871 20:58746440-58746462 CAGTTTCCACATCTGGAAAACGG + Intergenic
1176424158 21:6537701-6537723 GACACTGCACAGCTGGCAAGAGG - Intergenic
1176909870 21:14551839-14551861 TAGTTTGCACAGCTAGGAAGTGG + Intronic
1179699651 21:43146016-43146038 GACACTGCACAGCTGGCAAGAGG - Intergenic
1180100146 21:45580052-45580074 GAGTTTGCACGAGTGGCCAAAGG - Intergenic
1180308414 22:11148921-11148943 GATGTCGCACAGCTGGTAAATGG + Intergenic
1180546891 22:16510734-16510756 GATGTCGCACAGCTGGTAAATGG + Intergenic
1181899214 22:26138924-26138946 CAGTTTCCACATCTGGAAAATGG + Intergenic
1182087284 22:27569857-27569879 AAGGTTGCACAGCTAGCCAACGG + Intergenic
1182094438 22:27616457-27616479 CAGTTTTCTCATCTGGCAAATGG - Intergenic
1182111792 22:27728952-27728974 GAGTTTCAACAGCTGGAGAAAGG - Intergenic
1182117145 22:27763324-27763346 GGGTCAGCACAGCTGGCAAGGGG + Intronic
1182212290 22:28686621-28686643 GATGTTGCACAGCTGGTAAATGG - Intergenic
1182352379 22:29706061-29706083 CAGTTTGCTCAGCTAGAAAACGG + Intergenic
1183250545 22:36727104-36727126 CAGTTTGCTCACCTGTCAAATGG - Intergenic
1183457617 22:37931192-37931214 GAGTTTACTCAGCTGTGAAATGG + Intronic
1183527931 22:38335062-38335084 GAGTTTCCACATCTGGAAAGTGG - Intronic
1183935883 22:41261959-41261981 GAGTTTCTTCAGCTGGAAAATGG - Intronic
1184533879 22:45073273-45073295 GGCTTTGCACAGCTGGCCCATGG + Intergenic
1184846643 22:47091759-47091781 CAGTTTCCTCAGCTGGAAAAAGG - Intronic
949523312 3:4877435-4877457 CAGTTTGCACAGTTTGCATAGGG + Intronic
949531065 3:4955762-4955784 TAGTTTGCTCAGCTGTAAAATGG - Intergenic
950041841 3:9924642-9924664 AAGGTTACACAGCTAGCAAATGG - Intronic
950194672 3:11000698-11000720 CAGTTTGCACATCTGCAAAATGG + Intronic
950671850 3:14532100-14532122 AAGTTCCCACAGCTGGCGAATGG - Intronic
952314547 3:32221234-32221256 GAGGTTGCACAGCTGGTGGATGG - Intergenic
952314613 3:32221800-32221822 GAGGTTGCACAGCTGGCGGATGG + Intergenic
952989335 3:38817995-38818017 GAATCTGCACAGCTAGAAAAGGG + Intergenic
954636664 3:52074615-52074637 GAGGTCACACAGCTGGCAACAGG + Intergenic
955321000 3:57974247-57974269 CAGTTTGCCCAGCTGTAAAATGG - Intergenic
955945767 3:64192024-64192046 GAGTTTGCTTAGGTTGCAAAAGG - Intronic
955975305 3:64474509-64474531 AAGTTTTCTCATCTGGCAAATGG - Intergenic
956835928 3:73096005-73096027 AAATTTGCACAGCTGCTAAATGG - Intergenic
957340962 3:78896244-78896266 TAGTTTGCTCAGCTGTAAAATGG + Intronic
958690643 3:97461387-97461409 CAGTTTCCACATCTGGAAAATGG + Intronic
958820389 3:98967000-98967022 GAGTTTGCCCAGTTTGCCAATGG + Intergenic
960290967 3:115883804-115883826 GATTTGGCACAGATGGCTAAAGG + Intronic
960354785 3:116637856-116637878 GAGATTGCACAGCTAAGAAAAGG + Intronic
960547295 3:118930310-118930332 GAGTTTGGACTGTTGGGAAAGGG - Intronic
961642437 3:128373137-128373159 GAGGTCGCACAGCTGAGAAAGGG + Intronic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
962936587 3:140086997-140087019 GAGATTTCTCAGCTGACAAATGG + Intronic
965116398 3:164495294-164495316 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
967145249 3:186600963-186600985 GGATTTGCACAGCTGGCAAGAGG - Intergenic
968793638 4:2687440-2687462 GAGGTCACACAGCTAGCAAAAGG + Intronic
968911965 4:3480983-3481005 GAGTTAGCTCAGCTGTCAGAGGG + Intronic
969038278 4:4273739-4273761 GAGTTTGCCTAGCTCGCATAAGG - Intronic
969080612 4:4615111-4615133 CAGTTTCCACATCTGTCAAATGG - Intergenic
969681199 4:8644420-8644442 GAGTTTTCCAAGCTGGAAAACGG + Intergenic
969858251 4:10017048-10017070 GAATTTCCACAGGTGTCAAAGGG - Intronic
970516515 4:16836432-16836454 AAATTTGCCCAGCTGGAAAATGG - Intronic
970858321 4:20673885-20673907 GATTTAGCACAGCTTGTAAAAGG - Intergenic
971123860 4:23731111-23731133 GAGTTTACACAGCTGGGAAATGG - Intergenic
972961822 4:44462277-44462299 AAGTTCACACAGCTAGCAAATGG + Intergenic
973698968 4:53518192-53518214 GAGTCTGCTCAGGTGACAAATGG + Intronic
973840543 4:54856099-54856121 CAGTTTGCTGAGTTGGCAAATGG + Intergenic
975858614 4:78651796-78651818 AATTTTGCACAGCCAGCAAATGG + Intergenic
975910925 4:79265991-79266013 GAGTTTTCCCAACTGGCAAAAGG - Intronic
975941249 4:79649420-79649442 GAGGTGGCACATCTGGTAAATGG - Intergenic
976328334 4:83798568-83798590 CAGTTTGCTCAGCTGTAAAATGG - Intergenic
978024340 4:103853338-103853360 GATTTTGCAGAGCAGGCAATGGG - Intergenic
978702023 4:111659124-111659146 GAAGTTGCCAAGCTGGCAAAAGG + Intergenic
978852642 4:113356623-113356645 GAGTTGGCACAGCTTAAAAAAGG + Exonic
982136338 4:152277409-152277431 CAGTTCCCACAGCTAGCAAATGG + Intergenic
982375365 4:154684554-154684576 GAGGCTGCGCAGCTGGCAAAAGG + Intronic
984779910 4:183515697-183515719 CAGTTTGTTCAGCTGGAAAATGG + Intergenic
986224647 5:5801456-5801478 GTGTTTTCTCAGCTGGCAGAGGG + Intergenic
986801898 5:11269145-11269167 TAGTTTGCTCAGCTGTAAAATGG + Intronic
987793711 5:22601716-22601738 GATTTTTCACAGCTGTAAAATGG - Intronic
988849326 5:35163070-35163092 AAGTTTGCTCTGCTGGCAGAGGG + Intronic
989258482 5:39392643-39392665 GAGTTCGCACAGCTAACTAAGGG - Intronic
990336169 5:54774860-54774882 CAGTTTGCACAGCGGCAAAAGGG + Intergenic
990732876 5:58828602-58828624 GAATATGCACAGCTGGCAGGTGG - Intronic
992847018 5:80760782-80760804 AAGCTTGCCTAGCTGGCAAAGGG + Intronic
993288446 5:86032784-86032806 CAGTTTGCACAGCAGTAAAATGG - Intergenic
993369159 5:87070854-87070876 CAGGTGGCACAGCTGGCAAATGG + Intergenic
993952448 5:94193463-94193485 AAGGTTACACAGCTAGCAAATGG + Intronic
997150925 5:131494200-131494222 GAGTTTACAAATCTAGCAAATGG + Intronic
998414471 5:141936260-141936282 GAGTTAACACAGCTGGTAAGTGG + Intronic
999073598 5:148773837-148773859 GAGTTTGAATAACTAGCAAATGG + Intergenic
999091144 5:148936980-148937002 CAGTTTCCACATCTGTCAAATGG + Intronic
999434187 5:151550444-151550466 GACATTTCACAGCTGGCTAAGGG - Intronic
999530145 5:152454144-152454166 CAGTTTTCACAGCTGGTAAAGGG + Intergenic
1000822569 5:166002634-166002656 CATTTTCCACAGCTGGCTAAGGG + Intergenic
1001861343 5:175058314-175058336 CAGTTTTCACAGCTGTAAAATGG + Intergenic
1002102041 5:176862479-176862501 GAGATTGCCCAGCTGGGACATGG + Intronic
1002879685 6:1239949-1239971 AAGGTTGCACAGCCAGCAAACGG + Intergenic
1004612062 6:17251642-17251664 AAGTTTTCACAGCTCTCAAAGGG - Intergenic
1004618426 6:17312490-17312512 GAGATCACACAGCTGGCAAGTGG - Intergenic
1006381177 6:33698195-33698217 CAGGTTGCACAGCTGGGAAGTGG + Intronic
1006730239 6:36230896-36230918 GAGATTGCCCAGATGGCAAGAGG + Exonic
1007087689 6:39160911-39160933 GATTTGGCTCAGCAGGCAAAGGG + Intergenic
1007191322 6:40021334-40021356 GAGTTTGGACAGCTGCCAGTAGG - Intergenic
1007320595 6:41026339-41026361 GCGTTTCCAGTGCTGGCAAAGGG - Intergenic
1008313792 6:50013444-50013466 AACTGTGCACAGGTGGCAAAAGG + Intronic
1008680527 6:53867091-53867113 AAGTTTACACAGCTGGTAAGTGG - Intronic
1009061723 6:58404158-58404180 GTTTTTGCACAATTGGCAAAGGG - Intergenic
1011051620 6:83157201-83157223 GAGTTGGCACCTGTGGCAAACGG - Exonic
1011338852 6:86290035-86290057 GATTTTGCATCTCTGGCAAATGG + Intergenic
1011954418 6:93008136-93008158 GTGTCTACACAGCTGGTAAATGG + Intergenic
1014112217 6:117631240-117631262 GGGTTTGCAGAGCTGACAAAGGG - Intergenic
1014231345 6:118905945-118905967 TAGTTTGCCCAGTTGGCATAAGG - Intronic
1017035841 6:150266476-150266498 AAGGTGGCACAGCTGGAAAATGG - Intergenic
1017655679 6:156627034-156627056 GAAATTGAACATCTGGCAAAGGG - Intergenic
1019047771 6:169161574-169161596 GAGTTTGGACAGCTGGAGGATGG - Intergenic
1019707230 7:2502505-2502527 CAGTTTACTCAGCTGCCAAATGG - Intergenic
1021249139 7:18303183-18303205 AAGTTTTCAGAGATGGCAAATGG + Intronic
1021257777 7:18415099-18415121 GAGTTTACACAGCTGCTAATTGG + Intronic
1021904885 7:25323361-25323383 GAGTTTCCTCAGCTGCAAAATGG + Intergenic
1021963335 7:25894150-25894172 CAGTTTGCTCAGCTGGTAAATGG - Intergenic
1022990524 7:35702747-35702769 GAGGCTGCAAAGCTGGCCAAGGG - Intergenic
1023127320 7:36967525-36967547 AACTTTGCACTTCTGGCAAAGGG + Intronic
1024644136 7:51357080-51357102 GAGTTAGCACAGGCGGCAAAAGG - Intergenic
1024771321 7:52726563-52726585 CAGTTTGTACACCTGGGAAATGG - Intergenic
1027296331 7:76775785-76775807 ATGGTTGCACAGCTGGTAAATGG - Intergenic
1028263860 7:88698740-88698762 GAGTATTCACAGCTGACAGATGG + Intergenic
1030272773 7:107687529-107687551 CAGTTTCCTCAGCTGTCAAATGG - Intronic
1030585791 7:111417503-111417525 GAGTTAGCACAGTTGGGAAAGGG - Intronic
1031954411 7:127927752-127927774 GAGTTTTCAGAGCAGCCAAAGGG - Intronic
1032785508 7:135196744-135196766 TAGTTTCCACAGCTGTAAAATGG - Intronic
1033762979 7:144456728-144456750 GAGTTTGTAAAGCTGGTGAATGG - Intronic
1034255614 7:149723118-149723140 GCGTTTGGTCAGCTGGGAAAAGG + Intronic
1035344162 7:158187720-158187742 CATTTAGCACAGCTGTCAAACGG - Intronic
1037932356 8:22889176-22889198 GAGTTTGCACAGCTACAAAATGG + Intronic
1038938891 8:32282143-32282165 GAGTTTGCACAGCTGGACACAGG + Intronic
1038981119 8:32760777-32760799 GAGTTTGGATAACTGGCAATTGG - Intronic
1041388744 8:57330525-57330547 GAGTGTGGACGGCTGACAAAGGG - Intergenic
1043879624 8:85527551-85527573 GAGGTTGTACAGCTAGTAAATGG - Intergenic
1045379391 8:101608227-101608249 GAGGTTGCACAGCTGGCGCCTGG + Intronic
1045803418 8:106128096-106128118 CAGTTTGCACAGATGGTTAAGGG - Intergenic
1046856925 8:119042687-119042709 AAGTTTGCACAGCTAGTAAGTGG - Intronic
1047313361 8:123710765-123710787 CAGTTTCCTCAGCTGGAAAATGG + Intronic
1047331938 8:123897325-123897347 GAGTTTCCCCAGCTGTAAAATGG + Intronic
1047577885 8:126178406-126178428 GCTTTTGCACAGCTTGCAAATGG + Intergenic
1051325708 9:15965463-15965485 CAGGTTGCACAGCTTGCTAATGG - Intronic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1051721085 9:20038202-20038224 AAGCTTACACAGCTGGGAAATGG - Intergenic
1051728502 9:20113289-20113311 CACTTTTCACAGCTGGTAAATGG - Intergenic
1051810748 9:21047145-21047167 GAGTTAGCACTGCTAGCAAGTGG + Intergenic
1052776732 9:32740088-32740110 AAGTTTGCTCTGCTGGCAAGTGG + Intergenic
1053297076 9:36922773-36922795 AAGTCTGCACAGCTAGTAAATGG + Intronic
1053392920 9:37748745-37748767 CAGTTTCCCCATCTGGCAAAAGG + Intronic
1054722128 9:68614768-68614790 AAGTTTGCACAACTAGCAATTGG - Intergenic
1054857900 9:69920870-69920892 AAGGTGACACAGCTGGCAAACGG - Intergenic
1055152136 9:73014256-73014278 GAGGTTACACAGCTTGTAAATGG - Intronic
1056542807 9:87588546-87588568 CAGCTTTCACAGATGGCAAATGG + Intronic
1056826182 9:89877900-89877922 CAGTATGCACAGAAGGCAAACGG - Intergenic
1057225564 9:93291279-93291301 CAGTTTGCTCATCTGCCAAAGGG - Intronic
1057305148 9:93907929-93907951 GAGGTTGCACAGCTGGTGAGTGG - Intergenic
1057337201 9:94165736-94165758 CAGTTTGCTCATCTGTCAAATGG - Intergenic
1057530979 9:95846415-95846437 AAGATTGCACAGCTAGCAAGTGG + Intergenic
1058403113 9:104639624-104639646 GATTTTTCACTGCTGGCATATGG - Intergenic
1059686272 9:116639692-116639714 GACATTGGACAGCTGGAAAAAGG + Intronic
1059928711 9:119239634-119239656 AAGGTTTCACAGCTGGAAAAGGG - Intronic
1060250864 9:121986015-121986037 AAGTTCGCACAGCTGGGAAGAGG + Intronic
1060437255 9:123604629-123604651 GAGTTAGCACAGCAGGGAAGTGG + Intronic
1060559747 9:124533193-124533215 GGGTTTGCAGAGCTGGCCCAAGG - Intronic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1061266094 9:129505812-129505834 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
1061418982 9:130463171-130463193 CAGTTTTCACAGTAGGCAAAAGG + Intronic
1061676369 9:132218251-132218273 GAGGTTCCACAGCTGGTAAGGGG - Intronic
1062122324 9:134840433-134840455 CAGTTTCCTCAGCTGGAAAATGG - Intronic
1187807683 X:23138988-23139010 GTGTTTCCTCATCTGGCAAATGG - Intergenic
1188434341 X:30143336-30143358 GAGGTGGCACAGCTAGCGAATGG - Intergenic
1188692266 X:33144700-33144722 GAGTTTTCACAGAGAGCAAAAGG + Intronic
1188856689 X:35205096-35205118 GAGATTACACAGCTGGTAAGTGG + Intergenic
1189090757 X:38080178-38080200 GAGCATGCACAGCTGGTAAAAGG + Intronic
1191024960 X:55904395-55904417 TAGTTTTCACATCTGTCAAATGG - Intergenic
1195712012 X:107780501-107780523 AAGGTTACACAGCTGGCAAGGGG + Intronic
1195859145 X:109362460-109362482 AAGTTTGCACAGCTTGCTAGTGG - Intergenic
1196503619 X:116413950-116413972 AAGATTACACAGCTGGTAAATGG + Intergenic
1197809166 X:130426332-130426354 GAGGTTGCACAGCCAACAAACGG - Intergenic
1197971218 X:132117025-132117047 CAGTTAGCACATCTGTCAAATGG + Intronic
1198954192 X:142109501-142109523 GAATTGGAACAGCTGGGAAATGG + Intergenic
1199183917 X:144892643-144892665 GATGATGCACAGCTGGTAAATGG + Intergenic
1199900674 X:152169003-152169025 GAGTTTTCTCATCTGTCAAATGG - Intronic
1200215171 X:154365096-154365118 GAGTGTGCAGAGCTGGGAGAGGG + Intronic