ID: 900686091

View in Genome Browser
Species Human (GRCh38)
Location 1:3948550-3948572
Sequence CTTGTCTGAGTTTGCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 1, 2: 8, 3: 56, 4: 320}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900686091_900686094 10 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686094 1:3948583-3948605 CGCGTCACACTTTCTGTAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
900686091_900686099 24 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686099 1:3948597-3948619 TGTAAAGGGAAGGTAGATGGGGG No data
900686091_900686093 9 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686093 1:3948582-3948604 CCGCGTCACACTTTCTGTAAAGG 0: 1
1: 0
2: 0
3: 0
4: 46
900686091_900686096 21 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG No data
900686091_900686098 23 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686098 1:3948596-3948618 CTGTAAAGGGAAGGTAGATGGGG No data
900686091_900686095 14 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686095 1:3948587-3948609 TCACACTTTCTGTAAAGGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 219
900686091_900686097 22 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686097 1:3948595-3948617 TCTGTAAAGGGAAGGTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900686091 Original CRISPR CTTGTCTGAGTTTGCACAGC TGG (reversed) Intergenic
900524691 1:3122874-3122896 CTGGTTTGAATTTGCAAAGCTGG - Intronic
900686091 1:3948550-3948572 CTTGTCTGAGTTTGCACAGCTGG - Intergenic
900840098 1:5041807-5041829 CTTGCCAGAGTGTCCACAGCTGG + Intergenic
901070128 1:6512815-6512837 CTTGTTCGAGATGGCACAGCCGG - Intronic
901218012 1:7565477-7565499 CTTGGCTGAGTGTCCACATCAGG + Intronic
902265725 1:15262171-15262193 CTTGTCCCAGGCTGCACAGCAGG + Intronic
902758370 1:18564525-18564547 CCTGTCTGAGGTCACACAGCTGG - Intergenic
903281345 1:22251737-22251759 CTTGTCTGTGTTTCTTCAGCTGG - Intergenic
903419834 1:23210736-23210758 CTCATCTGAGTTTCCACACCAGG + Intergenic
903514935 1:23903863-23903885 CTTGTCTGAGGTTGCACAAAAGG + Intronic
904282993 1:29434346-29434368 CTTGTCTAAGGTCACACAGCTGG + Intergenic
904617347 1:31756941-31756963 CTTGTCTAAGTTCACACAGGTGG - Intronic
904874783 1:33646071-33646093 CTTGCCTTAATTAGCACAGCTGG + Intronic
905031693 1:34888333-34888355 ATTGTCTGAGGATGCCCAGCTGG + Intronic
907300472 1:53483691-53483713 CTTGCCTGAGGTCACACAGCTGG - Intergenic
907452971 1:54559085-54559107 CATGCCTGGGTTTGCACACCTGG + Intronic
907916476 1:58874539-58874561 CTTCCCTGAGGTTGCACAGGTGG + Intergenic
910191807 1:84602935-84602957 CTTGTCTCAGTTTCCCAAGCAGG + Intergenic
910209867 1:84782124-84782146 CCTTTCTGAGTTTGGAAAGCGGG - Intergenic
910525794 1:88176588-88176610 ATTGTCTAAGTTTGTTCAGCTGG - Intergenic
910655205 1:89611116-89611138 CTTGTCTAAGATAACACAGCTGG - Intergenic
912554129 1:110503978-110504000 CTTTTCTGAGAGTGCAAAGCAGG + Intergenic
912572535 1:110635023-110635045 CTTTTCTCAGTTTCCATAGCAGG + Intergenic
914293772 1:146299298-146299320 TTTGTCTGAATTTTCACAACTGG + Intergenic
914554816 1:148750081-148750103 TTTGTCTGAATTTTCACAACTGG + Intergenic
914992305 1:152509615-152509637 CTTGCCAGAGGTTGCACAGGTGG + Intergenic
917430737 1:174965725-174965747 CTTGTCTGTGAGTGCAGAGCAGG + Intronic
918473634 1:184900341-184900363 CTTGACTGAGGTTGTACAGCTGG - Intronic
919132823 1:193472788-193472810 TTTGTCTGTATCTGCACAGCTGG - Intergenic
919768809 1:201144161-201144183 CTTGAGGGAGTCTGCACAGCAGG + Intronic
920112483 1:203597127-203597149 CTTGCTTGAGATCGCACAGCTGG - Intergenic
920201477 1:204262309-204262331 CTTGTCTGCAGTTGCAGAGCTGG - Intronic
921052694 1:211522428-211522450 CTTGCCTGAGTTCAGACAGCTGG + Intergenic
922904323 1:229162422-229162444 CATGTCTGAGGTCACACAGCAGG - Intergenic
924418684 1:243886549-243886571 TTTGCACGAGTTTGCACAGCTGG - Intergenic
924562358 1:245167693-245167715 GTTGTGTAACTTTGCACAGCAGG + Intronic
1063162640 10:3430754-3430776 CTTGACCCAATTTGCACAGCTGG - Intergenic
1063378592 10:5570091-5570113 CTTGCCTGAGATTCCACACCTGG - Intergenic
1063485019 10:6411639-6411661 CGTGACTGTTTTTGCACAGCAGG + Intergenic
1064129124 10:12692145-12692167 CTTGTTTGATTTCACACAGCAGG + Intronic
1065100043 10:22322394-22322416 CTTGTCTGAGATTGGATGGCTGG + Intronic
1065183534 10:23150244-23150266 CCTGTCTAAGGCTGCACAGCTGG - Intergenic
1066360620 10:34726969-34726991 TTTGTCTGAGCTTACCCAGCTGG - Intronic
1067140251 10:43650280-43650302 CTTGTCCTAGTGTCCACAGCCGG - Intergenic
1069571496 10:69497094-69497116 CTTGCCTGAGGTTGCACAGCAGG + Intronic
1069789873 10:71012724-71012746 CTTGCCCAAGTTTGCACAGCAGG + Intergenic
1070672717 10:78389181-78389203 CTCACCTAAGTTTGCACAGCAGG - Intergenic
1072313458 10:94179447-94179469 CTGGCTTGAGGTTGCACAGCTGG - Intronic
1072419358 10:95276743-95276765 TTTGCCTGAGGTTGCACAGCTGG + Intronic
1072748273 10:97957547-97957569 TTTGCCTGAGGCTGCACAGCTGG + Intronic
1072763918 10:98080858-98080880 CTTGCCAGAATCTGCACAGCTGG + Intergenic
1073478181 10:103767974-103767996 CTTGCCTGAGGTCACACAGCTGG - Intronic
1074149634 10:110746627-110746649 ATTCTATGATTTTGCACAGCTGG + Intronic
1075871650 10:125775545-125775567 CTTCTCTGCCTCTGCACAGCCGG + Intronic
1077651535 11:3977464-3977486 CTTCTCTAAGTTTCCACAGCTGG - Intronic
1077700287 11:4435073-4435095 CTTGACTGAGATCACACAGCTGG - Intergenic
1078350366 11:10587895-10587917 CTTGCCTGAGGTTACACAGCTGG - Intronic
1078720164 11:13876901-13876923 CTTGCCGGAGGTCGCACAGCTGG - Intergenic
1079106316 11:17574588-17574610 TTTGTCTGAGGTCACACAGCAGG - Intronic
1079389115 11:20005794-20005816 CTTGCCTGAGGTCGGACAGCTGG + Intronic
1079400423 11:20102431-20102453 CTGGCCTGAGAGTGCACAGCGGG - Intronic
1079455804 11:20635296-20635318 CTTGTCTAGGGTTGCACAGATGG + Intronic
1080567953 11:33529579-33529601 CTTGCCTGACTTTTTACAGCTGG + Intergenic
1081187059 11:40056518-40056540 CTTAGCTGAGTTTACAAAGCAGG + Intergenic
1081541457 11:44037487-44037509 CTTCTCTGAGTCTGCAGTGCTGG + Intergenic
1082071304 11:47941946-47941968 CTTGCCTGAGATCGCACAGCAGG + Intergenic
1082205780 11:49432416-49432438 CTTGCCTAAGGTTACACAGCCGG + Intergenic
1083044186 11:59717914-59717936 CTTGTCCGAGATTGCACAAGGGG + Intronic
1083153645 11:60809480-60809502 CTTGCCTAAGGTGGCACAGCAGG + Intergenic
1083343902 11:61976340-61976362 CTTGCCTAAGATTGCGCAGCTGG + Intergenic
1083709665 11:64540426-64540448 CTGCTCTGAGTCTGCCCAGCCGG + Intergenic
1083807829 11:65085367-65085389 CTTGCCTGAACTTACACAGCAGG - Intronic
1084947503 11:72646439-72646461 CTTACCTGAGATGGCACAGCTGG + Intronic
1084948425 11:72651530-72651552 CTTGTCTAAGGTGACACAGCTGG - Intronic
1085907418 11:80780843-80780865 CTTGTCCAAGATGGCACAGCTGG + Intergenic
1086512842 11:87578267-87578289 CTTGTCTAAGTTTACACTGATGG + Intergenic
1086876484 11:92102530-92102552 ATTGTTTGAGTTTCCACAGTTGG - Intergenic
1086885147 11:92197284-92197306 CTTGTCTGGGGCTGCAGAGCGGG - Intergenic
1089252685 11:117176490-117176512 CTTGTCAGAGTTCTCTCAGCTGG - Intronic
1089344867 11:117784731-117784753 CTTGCCTGAGGTCACACAGCAGG - Intronic
1089456158 11:118627128-118627150 CTTGGCTAAGGTTGCATAGCAGG + Intronic
1089676763 11:120095677-120095699 CTTGTCAGAGTCAGCACAGGAGG + Intergenic
1089683382 11:120131991-120132013 CTTGCCTGAGTTCTCACAGTTGG + Intronic
1090498032 11:127233685-127233707 CTCGCCTGAGTTCACACAGCTGG + Intergenic
1090908106 11:131094950-131094972 CTTGCCTGAGGTCACACAGCTGG + Intergenic
1091183092 11:133625168-133625190 CTTGGCTGTTTTTGCACAGCTGG + Intergenic
1091226351 11:133958505-133958527 CTTGAGTGTGTTTGCACAGGTGG - Intergenic
1091847798 12:3670710-3670732 GTTGCCTGAGGTTACACAGCTGG + Intronic
1092005032 12:5061929-5061951 CTTGTCTGATTAAGCTCAGCAGG + Intergenic
1093637737 12:21491900-21491922 CTTGTCTGAGGTCACTCAGCAGG - Intronic
1093969803 12:25364614-25364636 CTTGCCTGAGTTTGTACTACTGG - Intergenic
1096256681 12:50066278-50066300 CTTGCCTGAGGTCACACAGCTGG + Intronic
1096635643 12:52957325-52957347 CTTGTCTGAGGTCACAGAGCTGG + Intergenic
1098378753 12:69845268-69845290 CTTGTCTTCTTTTTCACAGCTGG + Intronic
1099295013 12:80819652-80819674 CTTGTCTGTGTTCACAGAGCTGG - Intronic
1100109412 12:91220177-91220199 CCTGTCTGAGTTTCAAGAGCAGG - Intergenic
1100311587 12:93399962-93399984 TTTGTCTGAATTTTCACAACTGG + Exonic
1101273052 12:103168408-103168430 CTTTCCTGAGGTTGCACATCAGG + Intergenic
1102043948 12:109818052-109818074 CTTGCCTGAGGTCACACAGCAGG + Intronic
1102209685 12:111116940-111116962 CTGGCCTGAGGTTGCAGAGCTGG + Intronic
1102813177 12:115841578-115841600 CATGTCTGGGTTGGCAAAGCAGG + Intergenic
1103149128 12:118621791-118621813 CTTGCCTAAGATTACACAGCTGG - Intergenic
1104748418 12:131223873-131223895 TTATTCTCAGTTTGCACAGCGGG + Intergenic
1105564894 13:21535372-21535394 ATTATCTGAGTTTTCACAACTGG + Intronic
1107033757 13:35879670-35879692 CTTGTCTGAGTTTCAACCCCGGG + Intronic
1109751985 13:66706358-66706380 CTCGTCCAAATTTGCACAGCTGG - Intronic
1110011719 13:70344204-70344226 CTTTGCTGACTTGGCACAGCAGG - Intergenic
1110016087 13:70406069-70406091 TTTGGCTGAGTATGCAAAGCAGG - Intergenic
1112024194 13:95397448-95397470 GTTGACTGAGTTTGCAAAGCTGG + Intergenic
1112259943 13:97868853-97868875 GTTGTCTGACTTTCCCCAGCAGG + Intergenic
1114976955 14:28113859-28113881 CTTTTCTTAGGTTTCACAGCAGG - Intergenic
1118642074 14:67802167-67802189 CTGGTGTGAGTTTACACAGAGGG + Exonic
1119200175 14:72746410-72746432 CTCTTCTGAGTCTGAACAGCCGG - Intronic
1119207966 14:72808904-72808926 CTTGCCTGGGTTCGCACAGCAGG - Intronic
1121742246 14:96262355-96262377 CCTGTCTGAGGTCACACAGCTGG - Intronic
1121781705 14:96626172-96626194 ATTGCCTGAGAGTGCACAGCCGG - Intergenic
1122735771 14:103840277-103840299 TTTGTATGTGTTTGCACAGATGG - Intronic
1125753786 15:42048764-42048786 CTTGTCTGAGGTTACAGGGCTGG + Intronic
1126676547 15:51163664-51163686 CTTGCCTGAGGTTCCACAGCTGG - Intergenic
1127365945 15:58290503-58290525 CTCATCTGAGGTTACACAGCTGG + Intronic
1127386806 15:58473742-58473764 CTTGTCCAAGGTTACACAGCTGG + Intronic
1127550317 15:60031128-60031150 CTTGTATTAGTGTGCACATCAGG + Intronic
1128518327 15:68358202-68358224 CTTGTCTAAGTCTTCACAGGTGG + Intronic
1128562737 15:68679235-68679257 CTTGTCTGTGTTTGGTGAGCTGG + Intronic
1129940687 15:79494506-79494528 CTGGCCTGAGCTTGCACAGCTGG + Intergenic
1130153939 15:81333647-81333669 CTTCTCTGAGTTTCCACTGGTGG + Intronic
1132179122 15:99738451-99738473 CCTGCCTGAGGCTGCACAGCAGG + Intergenic
1133322974 16:4925710-4925732 CTGGTCCGAGTTTACACAGCTGG + Intronic
1135266344 16:21029557-21029579 CTTGTCTGAGGTTACATAGCTGG + Intronic
1135943876 16:26846850-26846872 CTTGTTTGAGGTTGCACAGCTGG + Intergenic
1137576818 16:49605357-49605379 CTTTCCCGAGGTTGCACAGCTGG - Intronic
1138229325 16:55325870-55325892 CTTGTCTAAGATCACACAGCAGG - Intronic
1138317132 16:56080014-56080036 CTTGCCTCAGGTTACACAGCTGG + Intergenic
1138417746 16:56880815-56880837 CTTGTCTAAGGTCACACAGCTGG - Intronic
1140405802 16:74710605-74710627 ATTGCCTGCGTTTTCACAGCAGG - Intergenic
1140653728 16:77117821-77117843 CCTGCCTGAGGTTACACAGCTGG + Intergenic
1140882758 16:79213736-79213758 CTCCTCTGAATTGGCACAGCTGG - Intergenic
1141757618 16:86002666-86002688 CTTGCCCGAGTTCACACAGCTGG + Intergenic
1142187697 16:88702227-88702249 CTTCTCTGTGTTTGCACTGGGGG - Intronic
1144365300 17:14538130-14538152 CTTGCCTGAGTTATCACATCAGG - Intergenic
1144853742 17:18257123-18257145 CTTGTCTGTGTTCTCACAGATGG - Intronic
1145102202 17:20086586-20086608 CTCTCCTGAGTTTGCAGAGCTGG + Intronic
1147875510 17:43617961-43617983 CTTGCCTGACTTTGCATAGGTGG + Intergenic
1147906308 17:43825421-43825443 CTTGTCCAAGGTTGCACAGCTGG + Intronic
1148483358 17:47975013-47975035 CTTGTCTTAGGCTCCACAGCTGG + Intronic
1148632167 17:49119621-49119643 CTTGTTTAAGTTCACACAGCAGG + Intergenic
1148844210 17:50519172-50519194 CTGGTCTCAGGTGGCACAGCTGG + Intronic
1149600298 17:57889096-57889118 CTTGTCTGAGGTCCCACAGCTGG - Intronic
1150323938 17:64240563-64240585 CTTGCCTGAGGTCACACAGCTGG - Intronic
1150594357 17:66591021-66591043 CTTGTCTGAGGTTACAGAGCTGG - Intronic
1150864304 17:68833519-68833541 CTTGCCTGAGTTCACAGAGCTGG - Intergenic
1151429473 17:74052732-74052754 CTGGGCTGAGCTTGCACACCCGG - Intergenic
1151684341 17:75637907-75637929 CTTCTCTGAGGTTACACAGCAGG - Exonic
1152035481 17:77869670-77869692 CTCGTCTGAGTTCACACAGCAGG - Intergenic
1152374985 17:79914353-79914375 CTTGCCTGAGGTCACACAGCTGG + Intergenic
1152503509 17:80729946-80729968 CTTGTCTCAGTTTTCACTGCGGG - Intronic
1152936252 17:83138840-83138862 CTCGTCTGAGTTTCAGCAGCAGG + Intergenic
1153054891 18:936065-936087 ATTGTCCAAGTTTCCACAGCTGG - Intergenic
1154171075 18:12050680-12050702 CTTGTTGGAGTTGGCCCAGCTGG + Intergenic
1157271921 18:46282834-46282856 CTTGTCTGTGGTCACACAGCTGG - Intergenic
1157470980 18:47988576-47988598 CTTGTCTATGGTTGCACAGCTGG + Intergenic
1157732732 18:50018661-50018683 CTTGCCTGAGGTCACACAGCTGG + Intronic
1162831137 19:13285434-13285456 CTTGTCTAAGGTCACACAGCAGG + Intronic
1163161472 19:15467151-15467173 CTTGTCTGAGGTCACACAGAGGG - Intergenic
1163721804 19:18901416-18901438 CCTGTCTGAGATTGCACATCAGG + Intronic
1164394615 19:27851826-27851848 CTTGTCTGAGGTCGACCAGCAGG + Intergenic
1164527418 19:29022368-29022390 CTCGCATGAGGTTGCACAGCTGG + Intergenic
1164705616 19:30317279-30317301 CTTGTCTGAGGTTACCCAGCTGG + Intronic
1164752611 19:30667944-30667966 CTTGTCTAAGGTCACACAGCTGG + Intronic
1165912758 19:39239255-39239277 CTTGGCCAAGTTTACACAGCAGG + Intergenic
1166538877 19:43592900-43592922 CTTGTCTGCGTGCGCACAGACGG - Exonic
1167021016 19:46876033-46876055 CTTGTCGGAGGGTGCAGAGCAGG - Intergenic
1167049228 19:47068471-47068493 CATGTCTGAGTCTGCCCAGCCGG - Intronic
1167146645 19:47684716-47684738 CTTGCCCAAGGTTGCACAGCTGG + Intronic
926286865 2:11495666-11495688 CTTGTCTGAGTCCACACACCTGG + Intergenic
927368587 2:22328156-22328178 CTTGTCCAAGTTTACACAACTGG - Intergenic
927416918 2:22889597-22889619 CTTGCCTGCGATTTCACAGCTGG - Intergenic
927890275 2:26743781-26743803 CTTGTCTGAGGTCGCCCAGGAGG + Intergenic
928136461 2:28691625-28691647 TTTGTCCAAGTCTGCACAGCTGG + Intergenic
928403154 2:30993780-30993802 CTTGTCTGAGGTCACACAGGTGG + Intronic
928617103 2:33051704-33051726 CTGCTCTGGGTTTGCAGAGCTGG + Intronic
929552153 2:42901235-42901257 CCTGTCTTAGTTTGGACTGCTGG + Intergenic
930817224 2:55610628-55610650 CTTGACTGAGATTATACAGCAGG - Intronic
931571087 2:63669910-63669932 CTTCCCTGAGTTCACACAGCTGG - Intronic
932184685 2:69683808-69683830 TTTGTCCCAGATTGCACAGCTGG + Intronic
933190667 2:79330158-79330180 CCTGTCTCAGTGTGGACAGCTGG - Intronic
933983532 2:87572697-87572719 CTTGCCTGAGTGGGAACAGCTGG - Intergenic
936310317 2:111378097-111378119 CTTGCCTGAGTGGGAACAGCTGG + Intergenic
936756357 2:115717469-115717491 CTTGCCCAAGTTTACACAGCTGG - Intronic
937265899 2:120614581-120614603 CCTGTCTGAATTAGCACAGCCGG - Intergenic
937370453 2:121293914-121293936 CTTGTCCAAACTTGCACAGCTGG + Intergenic
939355276 2:141093581-141093603 CAGCTCTGTGTTTGCACAGCAGG - Intronic
939840408 2:147181144-147181166 CTTGGCTGAATTTCCAGAGCTGG - Intergenic
941644599 2:168026454-168026476 CTTGTCTAAGATAACACAGCTGG + Intronic
941737336 2:168993330-168993352 TTTGTCTGGGACTGCACAGCTGG - Intronic
942517433 2:176768617-176768639 CCTGTCCGAGTTTGCACAGCTGG - Intergenic
945038299 2:205723083-205723105 TTTGTCTAAGGTTGCACAGCTGG - Intronic
945978340 2:216287860-216287882 CTTGGCTAAATTTGCACAGCTGG - Intronic
946002815 2:216497205-216497227 CTTGTCAGAGGTCCCACAGCTGG + Intergenic
947398470 2:229710191-229710213 CTTGTATGAGTGTGCTCAGCTGG - Intronic
947601877 2:231456425-231456447 CTACTCTGAGTTGACACAGCTGG + Intronic
1168797990 20:624344-624366 CATGTCTAAGTTTCCACATCTGG - Intergenic
1168806209 20:673774-673796 CTTCTCTGGGTTTCCTCAGCTGG + Intronic
1168821207 20:774890-774912 CTGACCTGAGGTTGCACAGCCGG - Intergenic
1168854657 20:1000292-1000314 CTTGTCCAAGGTCGCACAGCAGG - Intronic
1169985596 20:11440552-11440574 CTGGTCTGAGTTTGCTCACATGG + Intergenic
1170108301 20:12776514-12776536 CTTTTCTCATTTTGCAAAGCAGG - Intergenic
1170749981 20:19136884-19136906 CTTGCCCTAGGTTGCACAGCTGG + Intergenic
1171390100 20:24795720-24795742 CTTTGCTGAGATTTCACAGCGGG - Intergenic
1172011849 20:31850342-31850364 CTTGCCTGAGGTCACACAGCTGG - Intronic
1172046826 20:32086416-32086438 CTTGCCCTAGTGTGCACAGCTGG + Intronic
1173171168 20:40725000-40725022 CTTGACTGAGTTTACACAGCTGG + Intergenic
1173194177 20:40900325-40900347 CTTGCTTAAGTTTGCACAACTGG - Intergenic
1173563055 20:44020044-44020066 CTTGGCTGAGGTCGCACAGCTGG - Intronic
1173646733 20:44637959-44637981 CTTGCCTGAGGTCACACAGCTGG - Intronic
1173850159 20:46212779-46212801 CCTGTCTGAGGTTGCACAGCTGG - Intronic
1174362342 20:50036933-50036955 CTTGTCTAAGGTCACACAGCTGG - Intergenic
1174389310 20:50208085-50208107 CTTGTCTGAGGTCACACAGCTGG + Intergenic
1174514054 20:51077611-51077633 CTTGTTTGAGCATACACAGCTGG + Intergenic
1174556908 20:51402213-51402235 CAGGTCTGAGTTTACACAGTTGG - Intronic
1176555910 21:8253894-8253916 CATGTCTGAGTACGCACGGCCGG + Intergenic
1176574847 21:8436928-8436950 CATGTCTGAGTACGCACGGCCGG + Intergenic
1176973899 21:15296695-15296717 CTTGCCTGAGGTCACACAGCAGG + Intergenic
1177263725 21:18758325-18758347 CTTGTCTGAGTGGAAACAGCTGG + Intergenic
1179412865 21:41175561-41175583 CTGGTGGGGGTTTGCACAGCTGG - Intronic
1179412872 21:41175598-41175620 CTGGTGGGGGTTTGCACAGCTGG - Intronic
1179589054 21:42393398-42393420 GGTGTCTAAGTTTACACAGCTGG - Intronic
1180308413 22:11148914-11148936 CTTTTCTGATGTCGCACAGCTGG + Intergenic
1180546890 22:16510727-16510749 CTTTTCTGATGTCGCACAGCTGG + Intergenic
1180763182 22:18223970-18223992 CGGGGCTGAGTTTGCACAACAGG + Intergenic
1180772464 22:18400577-18400599 CGGGGCTGAGTTTGCACAACAGG - Intergenic
1180803843 22:18650193-18650215 CGGGGCTGAGTTTGCACAACAGG - Intergenic
1180806921 22:18719256-18719278 CGGGGCTGAGTTTGCACAACAGG + Intergenic
1180865734 22:19118552-19118574 CTTGTCTAAGGTCACACAGCTGG - Intronic
1181217876 22:21345066-21345088 CGGGGCTGAGTTTGCACAACAGG + Intergenic
1181681371 22:24497956-24497978 CTTGTCTGAGTGTGCAACCCTGG + Intronic
1182212292 22:28686628-28686650 CTTTTCCGATGTTGCACAGCTGG - Intergenic
1182365588 22:29776781-29776803 CTTGTCTGAGTTCGCACAGCCGG - Intergenic
1183096437 22:35554864-35554886 CTTGTCCAAGATGGCACAGCTGG + Intergenic
1203234304 22_KI270731v1_random:141565-141587 CGGGGCTGAGTTTGCACAACAGG - Intergenic
950024888 3:9813408-9813430 CTTGTCTGAGGTCACCCAGCTGG - Intronic
950093866 3:10316567-10316589 GTTTTCAAAGTTTGCACAGCAGG - Intronic
950197482 3:11019001-11019023 CTTTTCTGAAGTTGCACAGCTGG - Intronic
951219760 3:20056827-20056849 CTTGCCTGAGTTCACTCAGCTGG - Intronic
952448505 3:33407888-33407910 CTGATCTAAGTTTGCAAAGCAGG + Intronic
953781470 3:45874850-45874872 CTAGTCTGGGTTTGGACAGATGG - Intronic
953853754 3:46485197-46485219 CTGGCCTGAGTGAGCACAGCGGG - Intronic
953966389 3:47310239-47310261 CCTGTCTGAGGTAGCAGAGCTGG + Intronic
954145812 3:48633786-48633808 CCTGTCTGAGTTTGGACATGTGG - Intronic
955275405 3:57542387-57542409 CTTGCCTAAGGTTGCACAGCTGG - Intronic
955360451 3:58269486-58269508 CATGTCTGAGTCTGGAGAGCAGG + Intronic
956319033 3:67974761-67974783 GTTGTCTAAGGTTGCACATCAGG + Intergenic
957178713 3:76848452-76848474 CTTGGCTGAGAAAGCACAGCTGG + Intronic
957477860 3:80750208-80750230 TTTGTCTGAGCTTCCACAGTAGG - Intergenic
958270430 3:91492360-91492382 CTTGTCCCAGTTTGCAGAACTGG - Intergenic
958675049 3:97258733-97258755 CTTAACTGAATTTACACAGCTGG - Intronic
958888334 3:99754221-99754243 CTTGTCTAAGATTGTATAGCAGG - Intronic
959540742 3:107535076-107535098 CTTGTCTGAAGTCGCACAGCTGG + Intronic
960543449 3:118885746-118885768 ATTGACTAAGATTGCACAGCTGG + Intergenic
960972470 3:123149750-123149772 CTTACCTAAGGTTGCACAGCTGG + Intronic
961519447 3:127458348-127458370 TTTGCCTAAGGTTGCACAGCTGG + Intergenic
962064967 3:131969870-131969892 CTTGTCTGTGGTTACACAGCTGG - Intronic
962164374 3:133033813-133033835 ATTGTCTGGGTTTACACAGCTGG + Intergenic
963097767 3:141563709-141563731 CTTGTCTAAGGTCACACAGCTGG + Intronic
967256900 3:187602332-187602354 CTTTCCTGAGGTTGCCCAGCAGG - Intergenic
969283878 4:6190505-6190527 CTTATCTGAGCTTGCACAGGTGG - Intronic
969340561 4:6538227-6538249 CTTGTCTCAGGTCCCACAGCTGG + Intronic
970517945 4:16852066-16852088 CTTGTCTGAGATCACAAAGCTGG - Intronic
971123863 4:23731118-23731140 TTTACCTGAGTTTACACAGCTGG - Intergenic
971264684 4:25087493-25087515 CTTGTTTGAAGTTGCCCAGCTGG - Intergenic
971272349 4:25161704-25161726 CTGGTCTGTTTCTGCACAGCCGG + Intronic
976621102 4:87128101-87128123 GTTGACTGAGTTTCAACAGCAGG - Intronic
979739875 4:124136110-124136132 ATTTTCTAAGTTTGCACAGCAGG - Intergenic
983547764 4:168980415-168980437 CTTGTCTGTGTTTTCATAGGCGG - Intronic
984016915 4:174437676-174437698 CTTGTCTGTGTTTGGAAAGCTGG + Intergenic
986019951 5:3791770-3791792 CTTGTCTAAGTTCACAAAGCTGG - Intergenic
986248405 5:6032014-6032036 GTTGTGTGAAATTGCACAGCAGG - Intergenic
989125310 5:38047059-38047081 CTTGTCCGAGGTCACACAGCTGG + Intergenic
991185107 5:63797266-63797288 CTTGTCCGAGGATGCACAGTTGG + Intergenic
992219655 5:74559213-74559235 CTTGTCTTAGATTTAACAGCTGG - Intergenic
994808019 5:104477562-104477584 CTTGTCTCAGTTTGCTCATGGGG - Intergenic
995080380 5:108044610-108044632 TTTTTCTGATTTTGCTCAGCAGG + Intronic
995983914 5:118144725-118144747 CTTGCCTAAGATTACACAGCAGG - Intergenic
996409092 5:123137516-123137538 CTTGTGTTAGTTTGCTCAGAAGG - Intronic
997606510 5:135178968-135178990 GTTGACTGAGGTTGCACAACTGG + Intronic
997911838 5:137882273-137882295 CTTGTCTAAGGTTGCTTAGCTGG - Intronic
998414469 5:141936253-141936275 CGTGCCTGAGTTAACACAGCTGG + Intronic
998505854 5:142671889-142671911 CTTGTCTGTGGTCACACAGCTGG + Intronic
998940147 5:147272858-147272880 CTAGTCTAAGGTTACACAGCTGG + Intronic
999075515 5:148791846-148791868 CTTGTCTGAGTTGGCAGAGCCGG + Intergenic
999427613 5:151501094-151501116 TTTGTCTGAGGTCTCACAGCCGG - Intergenic
999530142 5:152454137-152454159 CTTGCCTCAGTTTTCACAGCTGG + Intergenic
1001057710 5:168463024-168463046 CTAGTCTCATTTTGCACGGCTGG - Intronic
1001151106 5:169227820-169227842 CTTGCCTAAATCTGCACAGCTGG + Intronic
1001266763 5:170279413-170279435 CTTGTCTGAGATCACACAGTGGG - Intronic
1001274798 5:170342716-170342738 ATTGTCTGACTGTGAACAGCAGG + Intergenic
1001314493 5:170632773-170632795 CTTGCCTGAGGTCACACAGCTGG - Intronic
1001399487 5:171438000-171438022 CTTGTCTGAGGTCACACAGCAGG - Intronic
1001528749 5:172447613-172447635 CTTGTCTGAGGTCACACAGTTGG + Intronic
1001762806 5:174222045-174222067 TTTGTCAGGGTTTGTACAGCTGG + Intronic
1005823486 6:29617054-29617076 CTTGTTTGAGATTTCATAGCAGG - Intronic
1007721289 6:43886946-43886968 CCTCTCTGAGGTTGCACAGCTGG + Intergenic
1007749179 6:44061667-44061689 CTTGTCTGATTTAACACAGGTGG - Intergenic
1008373391 6:50762729-50762751 CTAGTCTGAGTTTTCTCAGCAGG + Intronic
1008610449 6:53180450-53180472 ATTGCCTGTGTTTGTACAGCTGG + Intergenic
1008680529 6:53867098-53867120 CTCGTCCAAGTTTACACAGCTGG - Intronic
1008984720 6:57528987-57529009 CTTGTCCCAGTTTGCAGAACTGG + Intronic
1009172768 6:60421882-60421904 CTTGTCCCAGTTTGCAGAACTGG + Intergenic
1010154805 6:72780198-72780220 CTTCTCCAAGTTTGCACAGCTGG + Intronic
1010817782 6:80379107-80379129 CTTATCTGATTTTTCACATCAGG - Intergenic
1011335268 6:86252977-86252999 CTTGTCTGAGCTTACACAATAGG - Intergenic
1013391322 6:109689052-109689074 CTGGTCTGTGTTTGCCCAGTAGG - Intronic
1014254002 6:119143242-119143264 ATTGCCTAAGATTGCACAGCTGG + Intronic
1016504367 6:144762178-144762200 CTTGCTTGAGATTACACAGCTGG + Intronic
1017719507 6:157235134-157235156 CTTGCCTGAGTTTGTCCATCAGG - Intergenic
1019571739 7:1716021-1716043 CTTGCCTCTGTGTGCACAGCTGG - Intronic
1020466588 7:8486518-8486540 CTTGTCTGAGTTCACACAGCAGG - Intronic
1021334164 7:19377977-19377999 CTTGTGCGTGTTTGTACAGCTGG + Intergenic
1021343234 7:19489601-19489623 CTTTTCTGAGTTGGCAGGGCAGG - Intergenic
1021487675 7:21184555-21184577 CTTGCCCGAGGTTACACAGCCGG - Intergenic
1023158046 7:37271309-37271331 GTTGTCTGAATTTGCTCAGATGG + Intronic
1023840598 7:44095491-44095513 CTTGCCCAAGGTTGCACAGCTGG + Intergenic
1024708050 7:51982915-51982937 CTTGTCCGAGGTTATACAGCAGG - Intergenic
1024746548 7:52413573-52413595 TTTGTCTAAGGTTGCTCAGCTGG - Intergenic
1026434668 7:70385122-70385144 CTTGTGAGAGTCTGCACAACAGG - Intronic
1027171807 7:75878217-75878239 CTGGTCTGTTATTGCACAGCGGG - Intronic
1027404480 7:77845709-77845731 CTTGCCTAAGATTGCACAGATGG + Intronic
1027894455 7:84023593-84023615 CATGTCAGAGGTTGCAGAGCAGG + Intronic
1029280102 7:99429956-99429978 TGTGTCTGAGTTTGGAGAGCTGG - Intronic
1030250364 7:107437057-107437079 CTTGTCTAGGTTTGCATGGCCGG - Intronic
1030537202 7:110783359-110783381 CTTGTCTGAGGTCACAGAGCTGG + Intronic
1033778785 7:144645044-144645066 CTGGTCTGAGTTTGCAATGAAGG - Intronic
1034828499 7:154288451-154288473 CTGGTCTGAGGTCACACAGCTGG - Intronic
1035366977 7:158355252-158355274 TTTGCCCAAGTTTGCACAGCAGG - Intronic
1035796204 8:2359392-2359414 CTTGTCTACGCTTGCAGAGCCGG - Intergenic
1036480788 8:9137723-9137745 CTTGCCTGAGTTTCCTCATCAGG - Exonic
1038224399 8:25642421-25642443 GTTGTTCAAGTTTGCACAGCTGG - Intergenic
1039303455 8:36235622-36235644 CTTGTCTCAGGTTCCACAGCTGG - Intergenic
1040908976 8:52498968-52498990 CTTTGCTTAGTTTGCACTGCTGG + Intergenic
1043381253 8:79704532-79704554 CTTGTCTGAGGTCACACAGCTGG - Intergenic
1044237428 8:89847227-89847249 CTTTTCTAAGGTTACACAGCTGG - Intergenic
1045379389 8:101608220-101608242 CTTACCTGAGGTTGCACAGCTGG + Intronic
1047834547 8:128674123-128674145 CTAGTCTCAGTTTGCATAGCAGG - Intergenic
1048270306 8:133022857-133022879 TTTGTCTGAGGGTCCACAGCCGG - Intronic
1048276671 8:133071301-133071323 TGTGTCGGAGTTTGCCCAGCTGG + Intronic
1048304698 8:133275766-133275788 CTTGCCTGAGATCGCAGAGCTGG - Intronic
1048385617 8:133910082-133910104 CTTGTCTGAAGTCACACAGCTGG + Intergenic
1048653252 8:136504859-136504881 ATAGTCTCAGGTTGCACAGCAGG + Intergenic
1048771567 8:137901134-137901156 CTAGTCTAAGTTGGCACAGCTGG - Intergenic
1049245158 8:141558502-141558524 CCTGCCTGAGGTCGCACAGCTGG + Intergenic
1049341073 8:142112967-142112989 CTTGACTGGCTTTTCACAGCTGG + Intergenic
1053287918 9:36861796-36861818 CTACTCTGAGTGTGCACAGGAGG + Intronic
1053479396 9:38404820-38404842 CTTGTCAGAGATTGCAAGGCTGG - Intergenic
1053672001 9:40375795-40375817 CTTGTCTTTCTTTTCACAGCAGG + Intergenic
1053921816 9:43002153-43002175 CTTGTCTTTCTTTTCACAGCAGG + Intergenic
1053939513 9:43218292-43218314 CATATTTGATTTTGCACAGCAGG - Intergenic
1054383117 9:64515839-64515861 CTTGTCTTTCTTTTCACAGCAGG + Intergenic
1054512622 9:66000515-66000537 CTTGTCTTTCTTTTCACAGCAGG - Intergenic
1054826369 9:69577849-69577871 CTTATCTAAGGTAGCACAGCTGG + Intronic
1056272649 9:84961806-84961828 CTACTCTGAGTTTCCAAAGCAGG - Intronic
1056613920 9:88145484-88145506 CTTGTCTGTGTTCTCACAGTCGG - Intergenic
1057849084 9:98550668-98550690 GTGGCCTAAGTTTGCACAGCTGG - Intronic
1057935474 9:99234913-99234935 CTTGCCTGAGATTGTGCAGCAGG + Intergenic
1058528321 9:105882199-105882221 CTTTTCCAAGGTTGCACAGCTGG + Intergenic
1059335572 9:113566525-113566547 CTTGTCCAAGTTTGAGCAGCAGG + Intronic
1060050111 9:120372381-120372403 CTTGTCTAAGGTTGGCCAGCAGG - Intergenic
1060170154 9:121454533-121454555 CTTGCCTGAGGTTGCACAGCTGG + Intergenic
1061046425 9:128167538-128167560 CTTGTCTAGGGTTGCACAGCTGG + Intronic
1061090378 9:128422665-128422687 CTTGCCTGAGGTCACACAGCAGG + Intronic
1061286715 9:129627592-129627614 CTTGTCTGTGCTTACACAGCAGG + Intronic
1061544173 9:131294227-131294249 CTTGCCTGAGTTCCCACAGCAGG - Intronic
1061857112 9:133448451-133448473 GTTGTCTGAGGTCACACAGCTGG + Intronic
1203469298 Un_GL000220v1:109130-109152 CATGTCTGAGTACGCACGGCCGG + Intergenic
1203477119 Un_GL000220v1:153102-153124 CATGTCTGAGTACGCACGGCCGG + Intergenic
1186257622 X:7739898-7739920 CTGTTCTGAGTTTGCACATGAGG + Intergenic
1186684882 X:11915793-11915815 CTCTTCTGAGTTCACACAGCTGG - Intergenic
1186841674 X:13490464-13490486 CTTGTCCAAATTTGCACAGCTGG + Intergenic
1189461421 X:41246297-41246319 CTTGTCTGGGGTGGCTCAGCAGG + Intergenic
1189746417 X:44173175-44173197 CTGATCTGAATTTACACAGCAGG + Intronic
1190199130 X:48345200-48345222 CTTGTCTGAGGTCCCACAGCTGG - Intergenic
1190204823 X:48394458-48394480 CTTGTCTGAGGTCCCACAGCTGG + Intergenic
1190205713 X:48400945-48400967 CTTGTCTGAGGTCCCACAGCTGG - Intergenic
1190574571 X:51820293-51820315 CTTGTCTGTTTCTGCACAGAAGG + Intronic
1192496898 X:71622207-71622229 TTTGCCTGAGATTACACAGCTGG - Intergenic
1199479730 X:148285024-148285046 ATGGTCTGAGTTTGCATTGCAGG + Intergenic
1199501099 X:148506882-148506904 CTTGCCTGAATTTGCACAGTAGG + Intronic