ID: 900686096

View in Genome Browser
Species Human (GRCh38)
Location 1:3948594-3948616
Sequence TTCTGTAAAGGGAAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900686091_900686096 21 Left 900686091 1:3948550-3948572 CCAGCTGTGCAAACTCAGACAAG 0: 1
1: 1
2: 8
3: 56
4: 320
Right 900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG No data
900686090_900686096 28 Left 900686090 1:3948543-3948565 CCATTTGCCAGCTGTGCAAACTC 0: 1
1: 0
2: 3
3: 48
4: 379
Right 900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900686096 Original CRISPR TTCTGTAAAGGGAAGGTAGA TGG Intergenic
No off target data available for this crispr