ID: 900688425

View in Genome Browser
Species Human (GRCh38)
Location 1:3964493-3964515
Sequence TCTTGTCTGCAGCAGCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900688425_900688431 25 Left 900688425 1:3964493-3964515 CCGTGCAGCTGCTGCAGACAAGA No data
Right 900688431 1:3964541-3964563 TCAGATGCAGTCAAGTGACAGGG No data
900688425_900688427 -5 Left 900688425 1:3964493-3964515 CCGTGCAGCTGCTGCAGACAAGA No data
Right 900688427 1:3964511-3964533 CAAGAGCCACCTGGTGTACGTGG No data
900688425_900688430 24 Left 900688425 1:3964493-3964515 CCGTGCAGCTGCTGCAGACAAGA No data
Right 900688430 1:3964540-3964562 GTCAGATGCAGTCAAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900688425 Original CRISPR TCTTGTCTGCAGCAGCTGCA CGG (reversed) Intergenic
No off target data available for this crispr