ID: 900688700

View in Genome Browser
Species Human (GRCh38)
Location 1:3966198-3966220
Sequence CTGGGCTTGGGGTAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900688690_900688700 11 Left 900688690 1:3966164-3966186 CCTGCAGAGGGGCTGATTTGCCA No data
Right 900688700 1:3966198-3966220 CTGGGCTTGGGGTAGTGTCCTGG No data
900688688_900688700 22 Left 900688688 1:3966153-3966175 CCAGTGTGGCTCCTGCAGAGGGG No data
Right 900688700 1:3966198-3966220 CTGGGCTTGGGGTAGTGTCCTGG No data
900688694_900688700 -9 Left 900688694 1:3966184-3966206 CCAGTGCTATGGCCCTGGGCTTG No data
Right 900688700 1:3966198-3966220 CTGGGCTTGGGGTAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900688700 Original CRISPR CTGGGCTTGGGGTAGTGTCC TGG Intergenic
No off target data available for this crispr