ID: 900689722

View in Genome Browser
Species Human (GRCh38)
Location 1:3973381-3973403
Sequence CCATAGACACTGTGGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900689722_900689735 24 Left 900689722 1:3973381-3973403 CCTATTCCCCACAGTGTCTATGG No data
Right 900689735 1:3973428-3973450 TATTCCCCACAGTGTCTATTGGG No data
900689722_900689734 23 Left 900689722 1:3973381-3973403 CCTATTCCCCACAGTGTCTATGG No data
Right 900689734 1:3973427-3973449 ATATTCCCCACAGTGTCTATTGG No data
900689722_900689731 -3 Left 900689722 1:3973381-3973403 CCTATTCCCCACAGTGTCTATGG No data
Right 900689731 1:3973401-3973423 TGGGGACTCCAGCACAGTCGGGG No data
900689722_900689730 -4 Left 900689722 1:3973381-3973403 CCTATTCCCCACAGTGTCTATGG No data
Right 900689730 1:3973400-3973422 ATGGGGACTCCAGCACAGTCGGG No data
900689722_900689729 -5 Left 900689722 1:3973381-3973403 CCTATTCCCCACAGTGTCTATGG No data
Right 900689729 1:3973399-3973421 TATGGGGACTCCAGCACAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900689722 Original CRISPR CCATAGACACTGTGGGGAAT AGG (reversed) Intergenic
No off target data available for this crispr