ID: 900691442

View in Genome Browser
Species Human (GRCh38)
Location 1:3982921-3982943
Sequence CTGTGGGTACAGGGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900691434_900691442 26 Left 900691434 1:3982872-3982894 CCTTATAAGAAGAGGGGATGGAG No data
Right 900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900691442 Original CRISPR CTGTGGGTACAGGGAGAAGA TGG Intergenic
No off target data available for this crispr