ID: 900697041

View in Genome Browser
Species Human (GRCh38)
Location 1:4018996-4019018
Sequence CCCCATTGGATGTCAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900697034_900697041 17 Left 900697034 1:4018956-4018978 CCTTGAGCTGAGAAGACCGGGGC No data
Right 900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG No data
900697035_900697041 1 Left 900697035 1:4018972-4018994 CCGGGGCACATCCACGTCCACAT No data
Right 900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG No data
900697037_900697041 -10 Left 900697037 1:4018983-4019005 CCACGTCCACATTCCCCATTGGA No data
Right 900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900697041 Original CRISPR CCCCATTGGATGTCAGGCCA AGG Intergenic
No off target data available for this crispr