ID: 900697578

View in Genome Browser
Species Human (GRCh38)
Location 1:4021735-4021757
Sequence CCAGTGAGGAAATGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900697569_900697578 4 Left 900697569 1:4021708-4021730 CCCACATCACAGAGTGGACCTAG No data
Right 900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG No data
900697566_900697578 14 Left 900697566 1:4021698-4021720 CCTTGCCTGGCCCACATCACAGA No data
Right 900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG No data
900697568_900697578 9 Left 900697568 1:4021703-4021725 CCTGGCCCACATCACAGAGTGGA No data
Right 900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG No data
900697564_900697578 24 Left 900697564 1:4021688-4021710 CCCGCGGGGGCCTTGCCTGGCCC No data
Right 900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG No data
900697565_900697578 23 Left 900697565 1:4021689-4021711 CCGCGGGGGCCTTGCCTGGCCCA No data
Right 900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG No data
900697570_900697578 3 Left 900697570 1:4021709-4021731 CCACATCACAGAGTGGACCTAGC No data
Right 900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900697578 Original CRISPR CCAGTGAGGAAATGGGTGGC AGG Intergenic
No off target data available for this crispr