ID: 900697867

View in Genome Browser
Species Human (GRCh38)
Location 1:4023346-4023368
Sequence GCTCCTCCATGCCAGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900697867_900697874 10 Left 900697867 1:4023346-4023368 CCCAGGGGCTGGCATGGAGGAGC No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900697867 Original CRISPR GCTCCTCCATGCCAGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr