ID: 900697874

View in Genome Browser
Species Human (GRCh38)
Location 1:4023379-4023401
Sequence TCCTAGCACCTGCCACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900697863_900697874 17 Left 900697863 1:4023339-4023361 CCCGTGACCCAGGGGCTGGCATG No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data
900697859_900697874 26 Left 900697859 1:4023330-4023352 CCTGCAGCTCCCGTGACCCAGGG No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data
900697857_900697874 27 Left 900697857 1:4023329-4023351 CCCTGCAGCTCCCGTGACCCAGG No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data
900697867_900697874 10 Left 900697867 1:4023346-4023368 CCCAGGGGCTGGCATGGAGGAGC No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data
900697868_900697874 9 Left 900697868 1:4023347-4023369 CCAGGGGCTGGCATGGAGGAGCA No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data
900697864_900697874 16 Left 900697864 1:4023340-4023362 CCGTGACCCAGGGGCTGGCATGG No data
Right 900697874 1:4023379-4023401 TCCTAGCACCTGCCACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900697874 Original CRISPR TCCTAGCACCTGCCACACAC TGG Intergenic
No off target data available for this crispr