ID: 900700449

View in Genome Browser
Species Human (GRCh38)
Location 1:4045462-4045484
Sequence GCCCCTCTTGGAAAGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900700443_900700449 21 Left 900700443 1:4045418-4045440 CCCAAAGCCCTATTGAAATAAAA No data
Right 900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG No data
900700444_900700449 20 Left 900700444 1:4045419-4045441 CCAAAGCCCTATTGAAATAAAAC No data
Right 900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG No data
900700441_900700449 28 Left 900700441 1:4045411-4045433 CCTGTTCCCCAAAGCCCTATTGA No data
Right 900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG No data
900700446_900700449 13 Left 900700446 1:4045426-4045448 CCTATTGAAATAAAACAATAATA No data
Right 900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG No data
900700445_900700449 14 Left 900700445 1:4045425-4045447 CCCTATTGAAATAAAACAATAAT No data
Right 900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG No data
900700442_900700449 22 Left 900700442 1:4045417-4045439 CCCCAAAGCCCTATTGAAATAAA No data
Right 900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900700449 Original CRISPR GCCCCTCTTGGAAAGCTGCC TGG Intergenic