ID: 900700782

View in Genome Browser
Species Human (GRCh38)
Location 1:4047487-4047509
Sequence AAGGGGAGGAAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900700763_900700782 25 Left 900700763 1:4047439-4047461 CCAGGATCTGTGAGCAGGCAGGG No data
Right 900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900700782 Original CRISPR AAGGGGAGGAAGGAGGAGGA AGG Intergenic
No off target data available for this crispr