ID: 900703476

View in Genome Browser
Species Human (GRCh38)
Location 1:4061985-4062007
Sequence GCTCCTCCATGTCACCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900703476_900703479 -3 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703479 1:4062005-4062027 AGCAAACCCTGCATTGGCTCTGG No data
900703476_900703487 20 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703487 1:4062028-4062050 GAAGGTTGAGGCGGAGGCTCAGG No data
900703476_900703480 -2 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703480 1:4062006-4062028 GCAAACCCTGCATTGGCTCTGGG No data
900703476_900703488 24 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703488 1:4062032-4062054 GTTGAGGCGGAGGCTCAGGCTGG No data
900703476_900703481 2 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703481 1:4062010-4062032 ACCCTGCATTGGCTCTGGGAAGG No data
900703476_900703485 11 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703485 1:4062019-4062041 TGGCTCTGGGAAGGTTGAGGCGG No data
900703476_900703486 14 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703486 1:4062022-4062044 CTCTGGGAAGGTTGAGGCGGAGG No data
900703476_900703489 27 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703489 1:4062035-4062057 GAGGCGGAGGCTCAGGCTGGAGG No data
900703476_900703478 -9 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703478 1:4061999-4062021 TGGAGGAGCAAACCCTGCATTGG No data
900703476_900703484 8 Left 900703476 1:4061985-4062007 CCACCAGGGTGACATGGAGGAGC No data
Right 900703484 1:4062016-4062038 CATTGGCTCTGGGAAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900703476 Original CRISPR GCTCCTCCATGTCACCCTGG TGG (reversed) Intergenic