ID: 900704369

View in Genome Browser
Species Human (GRCh38)
Location 1:4070702-4070724
Sequence ATGTAGAATCAGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900704366_900704369 29 Left 900704366 1:4070650-4070672 CCTTTAGTTATTTGCAACATTTT No data
Right 900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900704369 Original CRISPR ATGTAGAATCAGAGAGAGGA AGG Intergenic
No off target data available for this crispr