ID: 900704494

View in Genome Browser
Species Human (GRCh38)
Location 1:4071856-4071878
Sequence GCTGCTGCTGAGCCACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900704485_900704494 22 Left 900704485 1:4071811-4071833 CCGTCATTGCAGGGAGGCCAGGA No data
Right 900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG No data
900704489_900704494 5 Left 900704489 1:4071828-4071850 CCAGGAACAGTGGCAGGGCCTGT No data
Right 900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900704494 Original CRISPR GCTGCTGCTGAGCCACTTCC AGG Intergenic
No off target data available for this crispr