ID: 900708315

View in Genome Browser
Species Human (GRCh38)
Location 1:4094388-4094410
Sequence TGGTGTCTCTCAGCCACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900708312_900708315 -5 Left 900708312 1:4094370-4094392 CCCGGCCAGGGTGGACACTGGTG No data
Right 900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG No data
900708313_900708315 -6 Left 900708313 1:4094371-4094393 CCGGCCAGGGTGGACACTGGTGT No data
Right 900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG No data
900708311_900708315 -4 Left 900708311 1:4094369-4094391 CCCCGGCCAGGGTGGACACTGGT No data
Right 900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG No data
900708314_900708315 -10 Left 900708314 1:4094375-4094397 CCAGGGTGGACACTGGTGTCTCT No data
Right 900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG No data
900708304_900708315 21 Left 900708304 1:4094344-4094366 CCTGCTGGGCTGTTAGGGAAAGA No data
Right 900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG No data
900708309_900708315 -3 Left 900708309 1:4094368-4094390 CCCCCGGCCAGGGTGGACACTGG No data
Right 900708315 1:4094388-4094410 TGGTGTCTCTCAGCCACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900708315 Original CRISPR TGGTGTCTCTCAGCCACCGC AGG Intergenic
No off target data available for this crispr