ID: 900710600

View in Genome Browser
Species Human (GRCh38)
Location 1:4111035-4111057
Sequence ATAGGCAAAGGGCTGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900710594_900710600 29 Left 900710594 1:4110983-4111005 CCTGCCACGTATCAACTTCAATG No data
Right 900710600 1:4111035-4111057 ATAGGCAAAGGGCTGTCCTGTGG No data
900710593_900710600 30 Left 900710593 1:4110982-4111004 CCCTGCCACGTATCAACTTCAAT No data
Right 900710600 1:4111035-4111057 ATAGGCAAAGGGCTGTCCTGTGG No data
900710595_900710600 25 Left 900710595 1:4110987-4111009 CCACGTATCAACTTCAATGCAAA No data
Right 900710600 1:4111035-4111057 ATAGGCAAAGGGCTGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900710600 Original CRISPR ATAGGCAAAGGGCTGTCCTG TGG Intergenic
No off target data available for this crispr