ID: 900713091

View in Genome Browser
Species Human (GRCh38)
Location 1:4127469-4127491
Sequence CTGGCCAACGGGCTGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900713091_900713107 29 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713107 1:4127521-4127543 GGGCGGCCGGGGCTCCTGGAGGG No data
900713091_900713098 9 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713098 1:4127501-4127523 CTTGGTCCACCTAATTGTGAGGG No data
900713091_900713099 12 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713099 1:4127504-4127526 GGTCCACCTAATTGTGAGGGCGG No data
900713091_900713104 18 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713104 1:4127510-4127532 CCTAATTGTGAGGGCGGCCGGGG No data
900713091_900713094 -9 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713094 1:4127483-4127505 GTTGGCCAGAACGCGCCACTTGG No data
900713091_900713101 16 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713101 1:4127508-4127530 CACCTAATTGTGAGGGCGGCCGG No data
900713091_900713105 25 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713105 1:4127517-4127539 GTGAGGGCGGCCGGGGCTCCTGG No data
900713091_900713102 17 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713102 1:4127509-4127531 ACCTAATTGTGAGGGCGGCCGGG No data
900713091_900713097 8 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713097 1:4127500-4127522 ACTTGGTCCACCTAATTGTGAGG No data
900713091_900713106 28 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900713091 Original CRISPR CTGGCCAACGGGCTGTGAGC TGG (reversed) Intergenic