ID: 900713092

View in Genome Browser
Species Human (GRCh38)
Location 1:4127480-4127502
Sequence AGTGGCGCGTTCTGGCCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900713092_900713101 5 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713101 1:4127508-4127530 CACCTAATTGTGAGGGCGGCCGG No data
900713092_900713098 -2 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713098 1:4127501-4127523 CTTGGTCCACCTAATTGTGAGGG No data
900713092_900713102 6 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713102 1:4127509-4127531 ACCTAATTGTGAGGGCGGCCGGG No data
900713092_900713099 1 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713099 1:4127504-4127526 GGTCCACCTAATTGTGAGGGCGG No data
900713092_900713110 30 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713110 1:4127533-4127555 CTCCTGGAGGGAGAAGTGCTGGG No data
900713092_900713097 -3 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713097 1:4127500-4127522 ACTTGGTCCACCTAATTGTGAGG No data
900713092_900713107 18 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713107 1:4127521-4127543 GGGCGGCCGGGGCTCCTGGAGGG No data
900713092_900713104 7 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713104 1:4127510-4127532 CCTAATTGTGAGGGCGGCCGGGG No data
900713092_900713109 29 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713109 1:4127532-4127554 GCTCCTGGAGGGAGAAGTGCTGG No data
900713092_900713105 14 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713105 1:4127517-4127539 GTGAGGGCGGCCGGGGCTCCTGG No data
900713092_900713106 17 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900713092 Original CRISPR AGTGGCGCGTTCTGGCCAAC GGG (reversed) Intergenic