ID: 900713095

View in Genome Browser
Species Human (GRCh38)
Location 1:4127488-4127510
Sequence GTGGACCAAGTGGCGCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900713095_900713104 -1 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713104 1:4127510-4127532 CCTAATTGTGAGGGCGGCCGGGG No data
900713095_900713098 -10 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713098 1:4127501-4127523 CTTGGTCCACCTAATTGTGAGGG No data
900713095_900713102 -2 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713102 1:4127509-4127531 ACCTAATTGTGAGGGCGGCCGGG No data
900713095_900713110 22 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713110 1:4127533-4127555 CTCCTGGAGGGAGAAGTGCTGGG No data
900713095_900713105 6 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713105 1:4127517-4127539 GTGAGGGCGGCCGGGGCTCCTGG No data
900713095_900713101 -3 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713101 1:4127508-4127530 CACCTAATTGTGAGGGCGGCCGG No data
900713095_900713109 21 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713109 1:4127532-4127554 GCTCCTGGAGGGAGAAGTGCTGG No data
900713095_900713099 -7 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713099 1:4127504-4127526 GGTCCACCTAATTGTGAGGGCGG No data
900713095_900713106 9 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713095_900713107 10 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713107 1:4127521-4127543 GGGCGGCCGGGGCTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900713095 Original CRISPR GTGGACCAAGTGGCGCGTTC TGG (reversed) Intergenic