ID: 900713100

View in Genome Browser
Species Human (GRCh38)
Location 1:4127507-4127529
Sequence CGGCCGCCCTCACAATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900713100_900713110 3 Left 900713100 1:4127507-4127529 CCACCTAATTGTGAGGGCGGCCG No data
Right 900713110 1:4127533-4127555 CTCCTGGAGGGAGAAGTGCTGGG No data
900713100_900713106 -10 Left 900713100 1:4127507-4127529 CCACCTAATTGTGAGGGCGGCCG No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713100_900713109 2 Left 900713100 1:4127507-4127529 CCACCTAATTGTGAGGGCGGCCG No data
Right 900713109 1:4127532-4127554 GCTCCTGGAGGGAGAAGTGCTGG No data
900713100_900713107 -9 Left 900713100 1:4127507-4127529 CCACCTAATTGTGAGGGCGGCCG No data
Right 900713107 1:4127521-4127543 GGGCGGCCGGGGCTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900713100 Original CRISPR CGGCCGCCCTCACAATTAGG TGG (reversed) Intergenic