ID: 900713106

View in Genome Browser
Species Human (GRCh38)
Location 1:4127520-4127542
Sequence AGGGCGGCCGGGGCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900713095_900713106 9 Left 900713095 1:4127488-4127510 CCAGAACGCGCCACTTGGTCCAC No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713092_900713106 17 Left 900713092 1:4127480-4127502 CCCGTTGGCCAGAACGCGCCACT No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713093_900713106 16 Left 900713093 1:4127481-4127503 CCGTTGGCCAGAACGCGCCACTT No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713096_900713106 -1 Left 900713096 1:4127498-4127520 CCACTTGGTCCACCTAATTGTGA No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713091_900713106 28 Left 900713091 1:4127469-4127491 CCAGCTCACAGCCCGTTGGCCAG No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data
900713100_900713106 -10 Left 900713100 1:4127507-4127529 CCACCTAATTGTGAGGGCGGCCG No data
Right 900713106 1:4127520-4127542 AGGGCGGCCGGGGCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900713106 Original CRISPR AGGGCGGCCGGGGCTCCTGG AGG Intergenic