ID: 900716111

View in Genome Browser
Species Human (GRCh38)
Location 1:4145448-4145470
Sequence ACTGACATGCTGTCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900716107_900716111 30 Left 900716107 1:4145395-4145417 CCAGGGGAGAGATTGGACTATTA No data
Right 900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900716111 Original CRISPR ACTGACATGCTGTCTGTGGT TGG Intergenic
No off target data available for this crispr