ID: 900718714

View in Genome Browser
Species Human (GRCh38)
Location 1:4161406-4161428
Sequence GGTGCTGTTGTCCGGGTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900718707_900718714 -2 Left 900718707 1:4161385-4161407 CCTCGCTGCTGTGCTGCCCTGGG No data
Right 900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG No data
900718700_900718714 28 Left 900718700 1:4161355-4161377 CCTCGGGGGAGCCTCTCCTGCGG No data
Right 900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG No data
900718703_900718714 17 Left 900718703 1:4161366-4161388 CCTCTCCTGCGGAAACGGCCCTC No data
Right 900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG No data
900718705_900718714 -1 Left 900718705 1:4161384-4161406 CCCTCGCTGCTGTGCTGCCCTGG No data
Right 900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG No data
900718704_900718714 12 Left 900718704 1:4161371-4161393 CCTGCGGAAACGGCCCTCGCTGC No data
Right 900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900718714 Original CRISPR GGTGCTGTTGTCCGGGTTCC GGG Intergenic
No off target data available for this crispr