ID: 900718801

View in Genome Browser
Species Human (GRCh38)
Location 1:4161734-4161756
Sequence CCCGCCCCCATGAGGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900718801_900718815 23 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718815 1:4161780-4161802 GCTCTCCATGGGCCCCCAGGAGG No data
900718801_900718810 -2 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718810 1:4161755-4161777 GGGCATGAGCCATGCGGGAGGGG No data
900718801_900718809 -3 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718809 1:4161754-4161776 GGGGCATGAGCCATGCGGGAGGG No data
900718801_900718807 -7 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718807 1:4161750-4161772 GGGCGGGGCATGAGCCATGCGGG No data
900718801_900718808 -4 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718808 1:4161753-4161775 CGGGGCATGAGCCATGCGGGAGG No data
900718801_900718806 -8 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718806 1:4161749-4161771 GGGGCGGGGCATGAGCCATGCGG No data
900718801_900718812 11 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718812 1:4161768-4161790 GCGGGAGGGGACGCTCTCCATGG No data
900718801_900718814 20 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718814 1:4161777-4161799 GACGCTCTCCATGGGCCCCCAGG No data
900718801_900718813 12 Left 900718801 1:4161734-4161756 CCACCAAACCTCATGGGGGCGGG No data
Right 900718813 1:4161769-4161791 CGGGAGGGGACGCTCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900718801 Original CRISPR CCCGCCCCCATGAGGTTTGG TGG (reversed) Intergenic
No off target data available for this crispr