ID: 900720294

View in Genome Browser
Species Human (GRCh38)
Location 1:4171660-4171682
Sequence CAGCTCTCATGCCTGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900720289_900720294 -9 Left 900720289 1:4171646-4171668 CCATTGCCCCTGCACAGCTCTCA No data
Right 900720294 1:4171660-4171682 CAGCTCTCATGCCTGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900720294 Original CRISPR CAGCTCTCATGCCTGGCACA TGG Intergenic
No off target data available for this crispr