ID: 900724259

View in Genome Browser
Species Human (GRCh38)
Location 1:4204944-4204966
Sequence AAGTTAGCTGAAATTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900724257_900724259 22 Left 900724257 1:4204899-4204921 CCTTCTTTTTACAGGTGAGGAAA No data
Right 900724259 1:4204944-4204966 AAGTTAGCTGAAATTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900724259 Original CRISPR AAGTTAGCTGAAATTCTTAA AGG Intergenic
No off target data available for this crispr