ID: 900725732

View in Genome Browser
Species Human (GRCh38)
Location 1:4215346-4215368
Sequence GTGTTCCCCGAAAAGAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725732_900725739 27 Left 900725732 1:4215346-4215368 CCATAGCTCTTTTCGGGGAACAC No data
Right 900725739 1:4215396-4215418 CTCCAGCACATGGCTGTCAGAGG No data
900725732_900725737 17 Left 900725732 1:4215346-4215368 CCATAGCTCTTTTCGGGGAACAC No data
Right 900725737 1:4215386-4215408 CACTTAACGCCTCCAGCACATGG No data
900725732_900725740 28 Left 900725732 1:4215346-4215368 CCATAGCTCTTTTCGGGGAACAC No data
Right 900725740 1:4215397-4215419 TCCAGCACATGGCTGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725732 Original CRISPR GTGTTCCCCGAAAAGAGCTA TGG (reversed) Intergenic
No off target data available for this crispr