ID: 900725733

View in Genome Browser
Species Human (GRCh38)
Location 1:4215376-4215398
Sequence GAGGCGTTAAGTGGTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725733_900725742 21 Left 900725733 1:4215376-4215398 CCCACACCACCACTTAACGCCTC No data
Right 900725742 1:4215420-4215442 AAGTTTGTTTGAGAACACAGTGG No data
900725733_900725740 -2 Left 900725733 1:4215376-4215398 CCCACACCACCACTTAACGCCTC No data
Right 900725740 1:4215397-4215419 TCCAGCACATGGCTGTCAGAGGG No data
900725733_900725743 24 Left 900725733 1:4215376-4215398 CCCACACCACCACTTAACGCCTC No data
Right 900725743 1:4215423-4215445 TTTGTTTGAGAACACAGTGGCGG No data
900725733_900725739 -3 Left 900725733 1:4215376-4215398 CCCACACCACCACTTAACGCCTC No data
Right 900725739 1:4215396-4215418 CTCCAGCACATGGCTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725733 Original CRISPR GAGGCGTTAAGTGGTGGTGT GGG (reversed) Intergenic
No off target data available for this crispr