ID: 900725737

View in Genome Browser
Species Human (GRCh38)
Location 1:4215386-4215408
Sequence CACTTAACGCCTCCAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725732_900725737 17 Left 900725732 1:4215346-4215368 CCATAGCTCTTTTCGGGGAACAC No data
Right 900725737 1:4215386-4215408 CACTTAACGCCTCCAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725737 Original CRISPR CACTTAACGCCTCCAGCACA TGG Intergenic
No off target data available for this crispr