ID: 900725739

View in Genome Browser
Species Human (GRCh38)
Location 1:4215396-4215418
Sequence CTCCAGCACATGGCTGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725732_900725739 27 Left 900725732 1:4215346-4215368 CCATAGCTCTTTTCGGGGAACAC No data
Right 900725739 1:4215396-4215418 CTCCAGCACATGGCTGTCAGAGG No data
900725735_900725739 -9 Left 900725735 1:4215382-4215404 CCACCACTTAACGCCTCCAGCAC No data
Right 900725739 1:4215396-4215418 CTCCAGCACATGGCTGTCAGAGG No data
900725734_900725739 -4 Left 900725734 1:4215377-4215399 CCACACCACCACTTAACGCCTCC No data
Right 900725739 1:4215396-4215418 CTCCAGCACATGGCTGTCAGAGG No data
900725733_900725739 -3 Left 900725733 1:4215376-4215398 CCCACACCACCACTTAACGCCTC No data
Right 900725739 1:4215396-4215418 CTCCAGCACATGGCTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725739 Original CRISPR CTCCAGCACATGGCTGTCAG AGG Intergenic
No off target data available for this crispr