ID: 900725740

View in Genome Browser
Species Human (GRCh38)
Location 1:4215397-4215419
Sequence TCCAGCACATGGCTGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725735_900725740 -8 Left 900725735 1:4215382-4215404 CCACCACTTAACGCCTCCAGCAC No data
Right 900725740 1:4215397-4215419 TCCAGCACATGGCTGTCAGAGGG No data
900725733_900725740 -2 Left 900725733 1:4215376-4215398 CCCACACCACCACTTAACGCCTC No data
Right 900725740 1:4215397-4215419 TCCAGCACATGGCTGTCAGAGGG No data
900725732_900725740 28 Left 900725732 1:4215346-4215368 CCATAGCTCTTTTCGGGGAACAC No data
Right 900725740 1:4215397-4215419 TCCAGCACATGGCTGTCAGAGGG No data
900725734_900725740 -3 Left 900725734 1:4215377-4215399 CCACACCACCACTTAACGCCTCC No data
Right 900725740 1:4215397-4215419 TCCAGCACATGGCTGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725740 Original CRISPR TCCAGCACATGGCTGTCAGA GGG Intergenic
No off target data available for this crispr