ID: 900725937

View in Genome Browser
Species Human (GRCh38)
Location 1:4216367-4216389
Sequence GAAAAGGAGAGATGAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900725937_900725945 28 Left 900725937 1:4216367-4216389 CCCTTCTCTCATCTCTCCTTTTC No data
Right 900725945 1:4216418-4216440 CAGTTTTGCATGAGTGTAGAGGG No data
900725937_900725944 27 Left 900725937 1:4216367-4216389 CCCTTCTCTCATCTCTCCTTTTC No data
Right 900725944 1:4216417-4216439 CCAGTTTTGCATGAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900725937 Original CRISPR GAAAAGGAGAGATGAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr